ID: 981446543

View in Genome Browser
Species Human (GRCh38)
Location 4:144845808-144845830
Sequence GATTATTGAGCAGACAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981446541_981446543 8 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
981446534_981446543 20 Left 981446534 4:144845765-144845787 CCCATGCTGTAGCCGTTACAATG 0: 1
1: 4
2: 2
3: 6
4: 62
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
981446542_981446543 -6 Left 981446542 4:144845791-144845813 CCAAAGGGAAGAACAGTGATTAT No data
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
981446533_981446543 28 Left 981446533 4:144845757-144845779 CCTTTTAGCCCATGCTGTAGCCG 0: 1
1: 0
2: 4
3: 10
4: 127
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
981446535_981446543 19 Left 981446535 4:144845766-144845788 CCATGCTGTAGCCGTTACAATGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 981446543 4:144845808-144845830 GATTATTGAGCAGACAGAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981446543 Original CRISPR GATTATTGAGCAGACAGAGC TGG Intergenic