ID: 981446544

View in Genome Browser
Species Human (GRCh38)
Location 4:144845809-144845831
Sequence ATTATTGAGCAGACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 206}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981446542_981446544 -5 Left 981446542 4:144845791-144845813 CCAAAGGGAAGAACAGTGATTAT No data
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206
981446533_981446544 29 Left 981446533 4:144845757-144845779 CCTTTTAGCCCATGCTGTAGCCG 0: 1
1: 0
2: 4
3: 10
4: 127
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206
981446534_981446544 21 Left 981446534 4:144845765-144845787 CCCATGCTGTAGCCGTTACAATG 0: 1
1: 4
2: 2
3: 6
4: 62
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206
981446535_981446544 20 Left 981446535 4:144845766-144845788 CCATGCTGTAGCCGTTACAATGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206
981446541_981446544 9 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446544 4:144845809-144845831 ATTATTGAGCAGACAGAGCTGGG 0: 1
1: 0
2: 0
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981446544 Original CRISPR ATTATTGAGCAGACAGAGCT GGG Intergenic