ID: 981446545

View in Genome Browser
Species Human (GRCh38)
Location 4:144845810-144845832
Sequence TTATTGAGCAGACAGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981446542_981446545 -4 Left 981446542 4:144845791-144845813 CCAAAGGGAAGAACAGTGATTAT No data
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180
981446533_981446545 30 Left 981446533 4:144845757-144845779 CCTTTTAGCCCATGCTGTAGCCG 0: 1
1: 0
2: 4
3: 10
4: 127
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180
981446534_981446545 22 Left 981446534 4:144845765-144845787 CCCATGCTGTAGCCGTTACAATG 0: 1
1: 4
2: 2
3: 6
4: 62
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180
981446541_981446545 10 Left 981446541 4:144845777-144845799 CCGTTACAATGGGGCCAAAGGGA No data
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180
981446535_981446545 21 Left 981446535 4:144845766-144845788 CCATGCTGTAGCCGTTACAATGG 0: 1
1: 0
2: 0
3: 2
4: 69
Right 981446545 4:144845810-144845832 TTATTGAGCAGACAGAGCTGGGG 0: 1
1: 0
2: 2
3: 13
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981446545 Original CRISPR TTATTGAGCAGACAGAGCTG GGG Intergenic