ID: 981452043

View in Genome Browser
Species Human (GRCh38)
Location 4:144909826-144909848
Sequence TAGGAAATATGGAAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981452033_981452043 30 Left 981452033 4:144909773-144909795 CCACTTTGCTGGGGAAAAGAAGG No data
Right 981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981452043 Original CRISPR TAGGAAATATGGAAGGGGCA GGG Intergenic
No off target data available for this crispr