ID: 981452172

View in Genome Browser
Species Human (GRCh38)
Location 4:144911255-144911277
Sequence CTGTCAGCTCAGAGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981452163_981452172 20 Left 981452163 4:144911212-144911234 CCCTCTCATGGCTTACCTTTTCC No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452162_981452172 21 Left 981452162 4:144911211-144911233 CCCCTCTCATGGCTTACCTTTTC No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452161_981452172 22 Left 981452161 4:144911210-144911232 CCCCCTCTCATGGCTTACCTTTT No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452166_981452172 5 Left 981452166 4:144911227-144911249 CCTTTTCCCTGTGAAGGAGAAAG No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452170_981452172 -2 Left 981452170 4:144911234-144911256 CCTGTGAAGGAGAAAGGGAAACT No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452169_981452172 -1 Left 981452169 4:144911233-144911255 CCCTGTGAAGGAGAAAGGGAAAC No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data
981452164_981452172 19 Left 981452164 4:144911213-144911235 CCTCTCATGGCTTACCTTTTCCC No data
Right 981452172 4:144911255-144911277 CTGTCAGCTCAGAGTGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981452172 Original CRISPR CTGTCAGCTCAGAGTGAGGA TGG Intergenic
No off target data available for this crispr