ID: 981454681

View in Genome Browser
Species Human (GRCh38)
Location 4:144939594-144939616
Sequence CCACATAGGCTCCCAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981454681_981454690 15 Left 981454681 4:144939594-144939616 CCCATCCTTGGGAGCCTATGTGG No data
Right 981454690 4:144939632-144939654 TGGTCATTTTAATTGTATTTGGG No data
981454681_981454686 -5 Left 981454681 4:144939594-144939616 CCCATCCTTGGGAGCCTATGTGG No data
Right 981454686 4:144939612-144939634 TGTGGAGACCCTTAATTTTATGG No data
981454681_981454689 14 Left 981454681 4:144939594-144939616 CCCATCCTTGGGAGCCTATGTGG No data
Right 981454689 4:144939631-144939653 ATGGTCATTTTAATTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981454681 Original CRISPR CCACATAGGCTCCCAAGGAT GGG (reversed) Intergenic
No off target data available for this crispr