ID: 981455468

View in Genome Browser
Species Human (GRCh38)
Location 4:144948206-144948228
Sequence CCTGAGAAGAAGGAGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981455468_981455472 9 Left 981455468 4:144948206-144948228 CCAGGCCACTCCTTCTTCTCAGG No data
Right 981455472 4:144948238-144948260 CTTATCTATTTTCCTGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981455468 Original CRISPR CCTGAGAAGAAGGAGTGGCC TGG (reversed) Intergenic
No off target data available for this crispr