ID: 981457675

View in Genome Browser
Species Human (GRCh38)
Location 4:144973418-144973440
Sequence TCCTAGTGATTCCGTCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981457675 Original CRISPR TCCTAGTGATTCCGTCACCC AGG (reversed) Intronic
903007413 1:20307958-20307980 TGCCACTGATCCCGTCACCCAGG + Intronic
903023871 1:20413283-20413305 TCCTTGTGAGTGGGTCACCCAGG + Intergenic
904222017 1:28979028-28979050 TCCTATTGGTTCTGTCACTCTGG + Intronic
904355415 1:29935804-29935826 TCCTAGTGGTTCTGTTACTCTGG + Intergenic
904923953 1:34031033-34031055 TCCTATTTATTCCTTCAACCTGG - Intronic
906957172 1:50384045-50384067 TCCAAATGATTTCATCACCCAGG + Intergenic
908721796 1:67134026-67134048 TCTCACTGATTCTGTCACCCAGG + Intronic
909781021 1:79547593-79547615 TTCTAGTGATTCCGTTTCTCTGG + Intergenic
909834939 1:80242108-80242130 TCCTAGTGATTCTGTCTCTATGG + Intergenic
909862467 1:80625591-80625613 TACAAATGATTCTGTCACCCAGG + Intergenic
910207841 1:84765464-84765486 GCCTAGTGCTTCTGACACCCTGG - Intergenic
911321437 1:96418008-96418030 TACAAATGATCCCGTCACCCAGG + Intergenic
913160199 1:116138490-116138512 TTCCGGTGACTCCGTCACCCAGG - Intergenic
916237355 1:162603698-162603720 TACAATTGATTCTGTCACCCAGG - Intergenic
916400080 1:164437834-164437856 TCCTATTGATTCTGTCTCTCTGG + Intergenic
916635341 1:166662132-166662154 TCCTATTGATTCTGTCTCTCTGG + Intergenic
917184314 1:172335852-172335874 TCCAAATGATCCTGTCACCCAGG - Intronic
919311780 1:195918286-195918308 GCCTAGTGATTCTGCCACCATGG + Intergenic
919394305 1:197025065-197025087 TATGAATGATTCCGTCACCCAGG + Intergenic
919409900 1:197229536-197229558 TATGAGTGATCCCGTCACCCAGG + Intergenic
919674130 1:200364946-200364968 TCCAAGTGATTCCGACACACAGG + Intergenic
919811890 1:201414049-201414071 ACCTAGTGATGCCACCACCCAGG + Intronic
920510019 1:206544107-206544129 ACCTAGCTATTCAGTCACCCAGG - Intronic
923244038 1:232113634-232113656 TACTAATGATCCTGTCACCCAGG - Intergenic
923441504 1:234024900-234024922 TACAAATGATTCCATCACCCAGG + Intronic
1064149561 10:12851189-12851211 TTCTGTTGATCCCGTCACCCAGG + Intergenic
1065279663 10:24122089-24122111 TTCTATTGATCCCATCACCCAGG + Intronic
1065306318 10:24372549-24372571 TACAATTGATCCCGTCACCCAGG - Intronic
1065739859 10:28787505-28787527 TACAATTGATTCCGTCACTCAGG + Intergenic
1066113649 10:32220260-32220282 TACAAATTATTCCGTCACCCAGG - Intergenic
1066359040 10:34712828-34712850 TACGATTGATTCCATCACCCAGG - Intronic
1067484293 10:46633078-46633100 TACAAGTGATCCTGTCACCCAGG + Intergenic
1067610467 10:47708568-47708590 TACAAGTGATCCTGTCACCCAGG - Intergenic
1069130728 10:64698694-64698716 TCCCAGTGATCCCATCACCCAGG - Intergenic
1069519564 10:69107922-69107944 TCCTAGTGGTTCTGTCTCTCTGG - Intergenic
1070858097 10:79624884-79624906 TCCTAGTGATCCCATCACCCAGG + Intergenic
1071019462 10:81035184-81035206 TTCAATTGATTCCATCACCCAGG - Intergenic
1071625876 10:87168827-87168849 TACAAGTGATCCTGTCACCCAGG - Intronic
1073536356 10:104280138-104280160 TCCTACTTACTCTGTCACCCAGG - Intronic
1074201132 10:111236393-111236415 TATGATTGATTCCGTCACCCAGG + Intergenic
1074448092 10:113536928-113536950 TACAAATGATCCCGTCACCCAGG - Intergenic
1074776126 10:116769482-116769504 TCCTGGTGCTTTCGCCACCCCGG - Intergenic
1074786491 10:116846740-116846762 TCCTGGTGATCCCATCACCTTGG + Intergenic
1076239346 10:128892298-128892320 TCCAAGTGATCCCATCACCCAGG - Intergenic
1077032647 11:476510-476532 CCCCAGTGATGCCGCCACCCAGG - Intronic
1078458190 11:11492144-11492166 TCCTCGTGTTTAAGTCACCCAGG + Intronic
1078661774 11:13293271-13293293 TTCTACTGATTCAGTCACACTGG - Intronic
1080092278 11:28362415-28362437 TCCTAATGATCCCATCACCCAGG + Intergenic
1081242938 11:40729042-40729064 TTCTATTGATCCTGTCACCCAGG - Intronic
1081334210 11:41843606-41843628 TACGAATGATTCCATCACCCAGG - Intergenic
1082681962 11:56185067-56185089 TACAAGTGATCCCATCACCCAGG + Intergenic
1082869104 11:57927603-57927625 TACAAATGATCCCGTCACCCAGG + Intergenic
1085922652 11:80977429-80977451 TATGACTGATTCCGTCACCCAGG + Intergenic
1086159429 11:83704934-83704956 TACAAATGATTCTGTCACCCAGG - Intronic
1086490104 11:87350427-87350449 TCCTATTGATTCTGTCTCTCTGG + Intergenic
1090187233 11:124746513-124746535 TCCCAGAGACTCCCTCACCCAGG + Exonic
1090315084 11:125779133-125779155 TACGAATGATCCCGTCACCCAGG + Intergenic
1090630505 11:128643339-128643361 TACAAATGATTCTGTCACCCAGG - Intergenic
1092182044 12:6452615-6452637 TCCAAGTGATTTCCTCACCTGGG - Intronic
1093305697 12:17514753-17514775 TACTAATGATCCCATCACCCAGG - Intergenic
1094201100 12:27795283-27795305 TCCTAGTTTTTCCATGACCCTGG + Intronic
1094754204 12:33447480-33447502 TCCAAATGATCCCATCACCCAGG - Intergenic
1095533846 12:43223333-43223355 TCCCAGTGAATCAGACACCCAGG - Intergenic
1095660259 12:44724304-44724326 TCCCAATGATTCCATCACCCAGG - Intronic
1096099710 12:48962560-48962582 TCTTAGGGTTTCTGTCACCCAGG - Intergenic
1097457156 12:59813557-59813579 TATTAATGATTCCGTCACCAAGG - Intergenic
1099970891 12:89499408-89499430 TACAATTGATTCCATCACCCAGG - Intronic
1101616035 12:106338253-106338275 TACCAGTGATTTCATCACCCAGG + Intronic
1103034423 12:117644908-117644930 TTCTGGTAATTACGTCACCCTGG + Intronic
1103891702 12:124243870-124243892 TGCAAATGATCCCGTCACCCAGG + Intronic
1103975527 12:124700312-124700334 TCTTACTCATTCTGTCACCCAGG + Intergenic
1106046011 13:26142783-26142805 TTCTATTGATCCCATCACCCAGG - Intronic
1106734302 13:32573432-32573454 TCCTATTGATTCTGTCTCTCTGG + Intergenic
1107181812 13:37470096-37470118 TCCTATTGATTCTGTCCCTCTGG + Intergenic
1107587222 13:41863862-41863884 TATAAATGATTCCGTCACCCAGG - Intronic
1108179224 13:47824433-47824455 TACAAATGATTCTGTCACCCAGG - Intergenic
1108349268 13:49575800-49575822 TACGAATAATTCCGTCACCCAGG - Intronic
1109392914 13:61716701-61716723 TCCCAGTGATTTCATCACCCAGG + Intergenic
1112254342 13:97815710-97815732 TACTAATGATTCCATCCCCCAGG - Intergenic
1113010632 13:105761780-105761802 TTCTAGTGTTTAAGTCACCCAGG + Intergenic
1114073409 14:19132776-19132798 TCCTAGTGGTGCCGGCGCCCAGG + Intergenic
1114088857 14:19267207-19267229 TCCTAGTGGTGCCGGCGCCCAGG - Intergenic
1114876308 14:26723993-26724015 TACAAGTGATTTCATCACCCAGG + Intergenic
1116129157 14:40832063-40832085 TCCCAGTGATTCCATCTCTCAGG + Intergenic
1117053120 14:51882156-51882178 TCCAAGATATTCCATCACCCCGG - Intronic
1118338993 14:64879498-64879520 TCCCGGAGAGTCCGTCACCCCGG - Intronic
1119973600 14:79000629-79000651 TCCATGTGATTCCCTCACACTGG + Intronic
1120687700 14:87557373-87557395 TCCTAGTGGTTCTGTCTCCCTGG - Intergenic
1121071446 14:91025922-91025944 TACAAATGATTCCGTCACCCAGG + Intronic
1125217857 15:37298215-37298237 TCCTATTGGTTCTGTCACTCTGG - Intergenic
1125263227 15:37850928-37850950 TCCCAATGATTCTGCCACCCAGG - Intergenic
1125406639 15:39359024-39359046 TCCTAATGATCCCCTGACCCTGG - Intergenic
1126171389 15:45698042-45698064 TTCAAGTGATTCCGCCTCCCGGG - Intergenic
1128524134 15:68399861-68399883 TACAAGTGATCCCGTCACCCAGG - Intronic
1131083137 15:89553961-89553983 TCCTTCTCATTCCTTCACCCGGG + Intergenic
1131729625 15:95266214-95266236 TTCAATTGAATCCGTCACCCTGG + Intergenic
1133809921 16:9154076-9154098 TCCTACTGATGCAGGCACCCAGG - Intergenic
1133945668 16:10346081-10346103 TCCAATTGATTCCATCACCCAGG - Intronic
1135116908 16:19731698-19731720 TCCTACTGATTCTGTCTCTCTGG - Intronic
1135622149 16:23965086-23965108 TACTAATGATTTCATCACCCAGG + Intronic
1135638963 16:24103638-24103660 TATGAATGATTCCGTCACCCAGG + Intronic
1135813003 16:25606784-25606806 TACAAGTGATCCTGTCACCCAGG + Intergenic
1135823113 16:25702383-25702405 TCCTAGTTATTTCGTCTCTCTGG - Intronic
1137483478 16:48872103-48872125 TCCCAATGATCCCATCACCCAGG + Intergenic
1139612245 16:68067305-68067327 TCTTTGTCATTCTGTCACCCAGG + Intronic
1140615767 16:76661226-76661248 TCCTAATGATTCTATCACACAGG - Intergenic
1140697267 16:77547493-77547515 TACAAATGATCCCGTCACCCAGG - Intergenic
1141060903 16:80868498-80868520 TCCCAGTGATCTCGTCACCTAGG - Intergenic
1141478195 16:84287986-84288008 TCCCAATGATCCCGTCACCCAGG - Intergenic
1145738187 17:27248460-27248482 TTCTATTGATCCCATCACCCAGG + Intergenic
1146734692 17:35228380-35228402 TTCAAGTGATTCTGTCACCTCGG + Intergenic
1146833820 17:36093741-36093763 TACAAGTGATTTCATCACCCAGG - Intergenic
1149361237 17:55898116-55898138 TCCTAATGATACCTCCACCCAGG + Intergenic
1149919213 17:60640620-60640642 TACGATTGATTCCGTCATCCAGG + Intronic
1150829716 17:68508581-68508603 TACAAGTGATCCCATCACCCAGG - Intergenic
1151614493 17:75200182-75200204 GTCTAGTGACTCTGTCACCCAGG + Intergenic
1152279750 17:79378482-79378504 TCCTAGCGAGTCCGACACCTGGG - Intronic
1153047931 18:873359-873381 TACAAGTGATGCCATCACCCAGG - Intergenic
1154142066 18:11833055-11833077 TTCGAGTCATTCTGTCACCCAGG + Intronic
1156508641 18:37616332-37616354 TCCCACTGGTTCTGTCACCCTGG + Intergenic
1159458137 18:68688958-68688980 TACAAATGATCCCGTCACCCAGG - Intronic
1159642561 18:70880726-70880748 ACCTCTTAATTCCGTCACCCTGG - Intergenic
1160109326 18:76010728-76010750 TATTAATGATTCTGTCACCCAGG - Intergenic
1160401795 18:78616089-78616111 TCCCAATGATCCTGTCACCCAGG - Intergenic
1162650882 19:12088068-12088090 ACCTGGTGATTCTGTAACCCTGG - Intergenic
1163738360 19:18995564-18995586 TCCTACTGACTCCTTGACCCCGG - Intronic
1164922655 19:32100987-32101009 TACAAGTGATTCTGTCACCAAGG + Intergenic
1165290869 19:34884289-34884311 TCCTATTTATTCTGTCTCCCTGG + Intergenic
1165964030 19:39559522-39559544 TCCTGGTGATTCCCTGCCCCTGG + Intergenic
1166681591 19:44770988-44771010 TACGACTGATCCCGTCACCCAGG + Intergenic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
1167690205 19:50980401-50980423 TCGAAGTCATTCCGCCACCCCGG - Exonic
1168498631 19:56875097-56875119 TCCTAGTGATTCCAACACCTCGG + Intergenic
925553536 2:5103268-5103290 TACAAATGATTCCATCACCCAGG + Intergenic
928411410 2:31057193-31057215 TACAAATGATTCCATCACCCAGG - Intronic
928640722 2:33296028-33296050 TCCTACTGATTCCTTAAGCCAGG + Intronic
929083818 2:38148170-38148192 TCCCAATGATCCCATCACCCAGG - Intergenic
932886481 2:75553793-75553815 TCCTAGTGGGTCAGTCACACAGG - Intronic
935232030 2:101107473-101107495 TCCTAGAGGTTCTGTCTCCCTGG + Intronic
935671073 2:105557652-105557674 TCCCAGTGACTCCGTCCCACAGG - Intergenic
937410110 2:121667656-121667678 TCCCTGAGATTCTGTCACCCAGG - Intergenic
938706219 2:133929849-133929871 TACAAATGATTCCATCACCCAGG - Intergenic
938788760 2:134657915-134657937 TACAAGTGATCCCATCACCCAGG - Intronic
939503637 2:143016825-143016847 TCCTACTGATCCCATCACCTAGG + Intronic
944952813 2:204771580-204771602 TTCTATTGATCCCATCACCCAGG - Intronic
947028205 2:225762782-225762804 TCCTAGTGATTCTGTTTCTCTGG + Intergenic
1168928735 20:1604221-1604243 TCCTGGTGATGCCCTCACCGTGG - Intronic
1168932545 20:1635680-1635702 TCCTGGTGATGCCCTCACCGTGG - Intronic
1168936502 20:1670322-1670344 TCCTGGTGATGCCCTCACCGTGG - Intergenic
1169215476 20:3791654-3791676 TCCAAGTCTCTCCGTCACCCAGG - Intronic
1170625502 20:18027009-18027031 TCCAGATGATCCCGTCACCCAGG - Intronic
1171212954 20:23330878-23330900 TCCTACTGATTCTGTTTCCCTGG + Intergenic
1173883129 20:46433949-46433971 TCCTATTGATTCTGTCTCTCTGG + Intergenic
1175585354 20:60134943-60134965 TCCTATTGGTTCCGTTTCCCTGG + Intergenic
1177928024 21:27243016-27243038 TCCTATTGATTCTGTCCCTCTGG + Intergenic
1178489912 21:33043011-33043033 TCATAGTGATTCAGGCACACTGG - Intergenic
1179648311 21:42789567-42789589 TACAACTGATCCCGTCACCCAGG - Intergenic
1181792041 22:25275837-25275859 TCCTACTGATTCCAGCACTCAGG - Intergenic
1183796872 22:40126327-40126349 TACAAGTGATTCCATCACTCAGG + Intronic
950322076 3:12065763-12065785 TATGATTGATTCCGTCACCCAGG - Intronic
955021573 3:55126684-55126706 TACGAATGATCCCGTCACCCAGG - Intergenic
955224131 3:57047319-57047341 TCTTACTTATTCTGTCACCCAGG - Intronic
956754554 3:72372335-72372357 TCCTACTGGTTCTGTCAACCGGG - Exonic
957481732 3:80806649-80806671 TATTATTGATTCCATCACCCAGG + Intergenic
958677697 3:97288165-97288187 TACAAATGATTCCTTCACCCAGG + Intronic
959249319 3:103920980-103921002 TACAAATGATCCCGTCACCCAGG - Intergenic
959947565 3:112142814-112142836 TTCAAATGATTCCATCACCCAGG + Intronic
961674938 3:128558927-128558949 ACCTCGTGATTCACTCACCCGGG - Intergenic
963980884 3:151535503-151535525 TACGATTGATTCCTTCACCCAGG - Intergenic
966726026 3:183109341-183109363 TACAAATGATCCCGTCACCCTGG + Intronic
972099005 4:35388486-35388508 TATGAGTGATTCCATCACCCAGG - Intergenic
973657483 4:53064205-53064227 TACAAGTGATCCCCTCACCCAGG + Intronic
973764897 4:54154056-54154078 TCCTACTGATTCTGTCTCTCTGG + Intronic
974528991 4:63082426-63082448 TCCTATTGATTCTGTCCCTCTGG - Intergenic
974625074 4:64415852-64415874 TCCTATTGATTCTGTCTCTCTGG - Intergenic
975040260 4:69737941-69737963 TACAAATGATTTCGTCACCCAGG + Intronic
977326687 4:95582748-95582770 TACAAGTGATTCCATCACCCAGG + Intergenic
977772521 4:100876401-100876423 ACCTTGTGATTCTGTGACCCAGG - Intronic
979367818 4:119846586-119846608 TTCTATTGATTCTGTCACCCAGG - Intergenic
979390678 4:120123747-120123769 TACAACTGATTCTGTCACCCAGG + Intergenic
979550937 4:121990322-121990344 TACAAATGATTCTGTCACCCAGG - Intergenic
981457675 4:144973418-144973440 TCCTAGTGATTCCGTCACCCAGG - Intronic
982420762 4:155194327-155194349 TACCAATGATTTCGTCACCCAGG + Intergenic
983524783 4:168749805-168749827 TACAAATGATTCTGTCACCCAGG + Intronic
983985381 4:174053396-174053418 TACAAATGATCCCGTCACCCAGG - Intergenic
985915992 5:2919676-2919698 TCCTAGTGCTTCCTTCCCGCTGG + Intergenic
987928785 5:24375924-24375946 TACAGGTGATTCCGTCACCCAGG - Intergenic
988587479 5:32520290-32520312 TACAAATGATTCCATCACCCAGG - Intergenic
989673692 5:43949668-43949690 TCCCAATGATTCCATCCCCCAGG + Intergenic
991570402 5:68047765-68047787 TCCCAGTGATCCCATTACCCAGG - Intergenic
991728945 5:69563618-69563640 TACAAATGATCCCGTCACCCTGG + Intronic
991805375 5:70418764-70418786 TACAAATGATCCCGTCACCCTGG + Intergenic
991866009 5:71064258-71064280 TACAAATGATCCCGTCACCCTGG - Intronic
992220565 5:74568037-74568059 TACAAGTGATCCCATCACCCAGG + Intergenic
992465331 5:76998689-76998711 TACGAGTGATTCCATCACCCAGG - Intergenic
993185111 5:84607729-84607751 TCCTATTGATTCTGTTTCCCTGG - Intergenic
993439021 5:87932312-87932334 TACAAATGATCCCGTCACCCAGG - Intergenic
993562798 5:89432534-89432556 TCCCAATGATCCTGTCACCCAGG - Intergenic
994709450 5:103248838-103248860 TACAAATGATTCTGTCACCCAGG - Intergenic
995446715 5:112252748-112252770 TCCTAATGATCCCGTCACCCAGG - Intronic
997796379 5:136815538-136815560 TACAAATGATCCCGTCACCCAGG + Intergenic
1000092105 5:157938729-157938751 TCCTATTGGTTCTGTCTCCCTGG - Intergenic
1001062444 5:168504290-168504312 TCCTCGTGATTCGCTCACCTTGG - Intronic
1001608800 5:172983616-172983638 AGCTAGGGATTCGGTCACCCGGG - Intergenic
1002675912 5:180912460-180912482 TCCTAGTGGTTCTGTTACTCTGG + Intronic
1003640991 6:7874897-7874919 TCCTATTGATTCTGTCTCTCTGG - Intronic
1003750667 6:9051659-9051681 TACAATTGATTCTGTCACCCAGG - Intergenic
1004611972 6:17250715-17250737 TACTGATGATCCCGTCACCCAGG + Intergenic
1005439008 6:25844964-25844986 CCCTAGTGAGTTTGTCACCCCGG + Exonic
1010611581 6:77960262-77960284 TCCCAATGATCCCTTCACCCAGG + Intergenic
1012005258 6:93705911-93705933 TACAAATGATTTCGTCACCCAGG - Intergenic
1012201929 6:96417144-96417166 TACAAATGATCCCGTCACCCAGG - Intergenic
1012639930 6:101597285-101597307 TACAAATGATTCTGTCACCCAGG - Intronic
1013416681 6:109931872-109931894 TCCTATTGATTCTGTCCCTCTGG - Intergenic
1014288411 6:119529723-119529745 TACGAATGATTCCATCACCCAGG + Intergenic
1014642388 6:123928313-123928335 TACAATTGATTCCATCACCCAGG - Intronic
1014829011 6:126079626-126079648 TACAAATGATTCCTTCACCCAGG - Intergenic
1020878048 7:13722911-13722933 TCCTTGTGATTCCCTTCCCCTGG - Intergenic
1020987000 7:15148411-15148433 TACAAGTGATTTCATCACCCAGG + Intergenic
1021325472 7:19261190-19261212 TACTAATGATACCGTCATCCAGG - Intergenic
1021383694 7:20001650-20001672 TACAAATGATCCCGTCACCCAGG - Intergenic
1022326578 7:29337590-29337612 ACCTACTGATGCTGTCACCCAGG + Intronic
1022534741 7:31090499-31090521 TACAATTGATCCCGTCACCCAGG + Intronic
1023354405 7:39352828-39352850 TTCTATTGCTTCCATCACCCAGG + Intronic
1023653565 7:42396293-42396315 TACCAGTGATCCCATCACCCAGG + Intergenic
1024652175 7:51413513-51413535 TCCCAGTGATCCCATCTCCCAGG - Intergenic
1025037352 7:55604129-55604151 TCCCAGTGATCCCATCTCCCAGG - Intergenic
1026480102 7:70771304-70771326 TTCTAATGATGCCCTCACCCGGG + Intronic
1026976825 7:74503839-74503861 TACAAGTGATCTCGTCACCCAGG + Intronic
1028868942 7:95744641-95744663 TACAAATGATTCCATCACCCAGG - Intergenic
1030104080 7:105971948-105971970 TCATAGTTATTCAGTCACCCTGG - Intronic
1031974535 7:128085324-128085346 TCCAAGTCACTTCGTCACCCTGG - Intronic
1032403875 7:131642065-131642087 TCCTAGGGGCTGCGTCACCCTGG - Intergenic
1033663883 7:143423165-143423187 TGGAAGTGTTTCCGTCACCCAGG + Intergenic
1034760143 7:153664723-153664745 TCATCGTGATTCAGCCACCCTGG - Intergenic
1035055284 7:156031178-156031200 TCCTATTGGTTCTGTCTCCCTGG - Intergenic
1038162891 8:25056882-25056904 TACAAATGATTTCGTCACCCAGG + Intergenic
1039459401 8:37730821-37730843 TCGTAGTTATTCCTTGACCCTGG - Intergenic
1040652350 8:49463952-49463974 TCCTATTGATTCTGTCTCCCTGG - Intergenic
1042492451 8:69415446-69415468 TCCTATTGATTCTGTCTCTCTGG - Intergenic
1042868287 8:73374951-73374973 TACTAATGATCCTGTCACCCAGG - Intergenic
1043453894 8:80394926-80394948 TCCCAGTTACTCTGTCACCCAGG - Intergenic
1043968028 8:86501109-86501131 TACAAGTGATTTTGTCACCCAGG - Intronic
1044320767 8:90798378-90798400 TACAAATGATTCCATCACCCAGG + Intronic
1044931218 8:97253544-97253566 TGCAACTGATTCCATCACCCTGG + Intergenic
1045411157 8:101920788-101920810 TATCAGTGATTCTGTCACCCAGG - Intronic
1045940406 8:107732078-107732100 TCCTCATGATTCCCACACCCAGG + Intergenic
1046451360 8:114394909-114394931 TACAAGTGATTCCGTCACCCAGG - Intergenic
1046627071 8:116586288-116586310 TCCTATTGATTCTGTTTCCCTGG - Intergenic
1048550428 8:135428259-135428281 CCCCAGTGATTCTGTCTCCCTGG + Intergenic
1050677033 9:8067917-8067939 TACAGGTGATCCCGTCACCCAGG + Intergenic
1051309607 9:15756465-15756487 TACGAATGATTCTGTCACCCAGG + Intronic
1056465768 9:86852929-86852951 TACAATTGATCCCGTCACCCAGG + Intergenic
1057881748 9:98797193-98797215 TCCCAACGATCCCGTCACCCAGG + Intergenic
1185615998 X:1422460-1422482 TCCTAGGGGTTCTGTTACCCTGG + Intronic
1186600785 X:11034598-11034620 TACAAATGATCCCGTCACCCAGG - Intergenic
1187269055 X:17763135-17763157 TACAAATGATCCCGTCACCCAGG - Intergenic
1187320472 X:18233521-18233543 TACAAATGATCCCGTCACCCAGG + Intergenic
1188225124 X:27588098-27588120 TACAAATGATCCCGTCACCCAGG + Intergenic
1188461120 X:30428447-30428469 TCCCAGTGATTCCATCACCCAGG - Intergenic
1189542995 X:42012051-42012073 TACAAATGATCCCGTCACCCAGG - Intergenic
1190721285 X:53150815-53150837 TCCTATTGATTCTGTTTCCCTGG - Intergenic
1191605111 X:63052634-63052656 TACAACTGATCCCGTCACCCAGG - Intergenic
1196371505 X:114984432-114984454 TATGAATGATTCCGTCACCCAGG - Intergenic
1197115447 X:122827084-122827106 TATGAGTGATTCTGTCACCCAGG - Intergenic
1198558294 X:137819624-137819646 TACAAATGATCCCGTCACCCAGG - Intergenic
1198914867 X:141658758-141658780 TACAAGTGATCCTGTCACCCAGG - Intronic
1200373248 X:155750337-155750359 TACAACTGATCCCGTCACCCAGG - Intergenic
1200691940 Y:6314671-6314693 TCCAAGTGATTCTGTGACCTGGG - Intergenic
1200942061 Y:8794326-8794348 TACAAGTGATCCTGTCACCCAGG - Intergenic
1201043332 Y:9860052-9860074 TCCAAGTGATTCTGTGACCTGGG + Intergenic