ID: 981464721

View in Genome Browser
Species Human (GRCh38)
Location 4:145055094-145055116
Sequence TACCCAAAAGAGCTGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 506
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 449}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981464719_981464721 1 Left 981464719 4:145055070-145055092 CCAGAAATCCAACATCTGCATAT 0: 1
1: 0
2: 2
3: 43
4: 509
Right 981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG 0: 1
1: 0
2: 3
3: 53
4: 449
981464720_981464721 -7 Left 981464720 4:145055078-145055100 CCAACATCTGCATATATACCCAA 0: 1
1: 0
2: 24
3: 411
4: 2977
Right 981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG 0: 1
1: 0
2: 3
3: 53
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981464721 Original CRISPR TACCCAAAAGAGCTGAATAA AGG Intronic
901480569 1:9522080-9522102 TACCCAAAAGAATTGAAAACAGG + Intergenic
902106745 1:14043420-14043442 TACCCAAAATAACTGAAATAAGG - Intergenic
903518897 1:23932353-23932375 TACCCAAAGGATTTGAATACAGG - Intergenic
904857868 1:33513184-33513206 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
905114562 1:35626168-35626190 GACCCCAAAGAGCAGAAAAAGGG - Intronic
905160780 1:36032040-36032062 TACCCAGAATAGCTGAAAACAGG - Intronic
905450938 1:38055764-38055786 TAGCCAAAAGCGCTGGGTAATGG + Intergenic
906272588 1:44492420-44492442 TACCCAAAAGAACTGAAATTAGG + Intronic
906304901 1:44711180-44711202 TACCCCAAAGAACTGAAAACAGG - Intronic
906440859 1:45842776-45842798 TCCCCAAAAGAACTGAAGACAGG - Intronic
906763044 1:48396385-48396407 TACCCAAAAGAGTTGAAAGCAGG + Intronic
906971827 1:50523251-50523273 TACCCAAAAGAACTGAAAACAGG - Intronic
907057621 1:51385561-51385583 TACCCAAAAGAACTGAAAGCAGG + Intronic
907925133 1:58948810-58948832 TCCTCAAAAGAGTTGAATATAGG - Intergenic
908009410 1:59760448-59760470 TACCCAAAAGAACTGAAAGTAGG + Intronic
908980009 1:69944493-69944515 TATCCAAAAGAACTGAAATAGGG - Intronic
909511658 1:76459975-76459997 TTCCCAAAAGAACTGAAAACAGG - Intronic
909568659 1:77083736-77083758 TCTCCAAAAGAGATGAACAAAGG - Intergenic
909685839 1:78347430-78347452 CACCCAAAAGAACTGAAAACAGG - Intronic
911432823 1:97814085-97814107 TTTCCAAAAGAGATCAATAAAGG - Intronic
911675329 1:100652357-100652379 TAACCAAAACAGCAGAATACTGG + Intergenic
912781621 1:112554626-112554648 TACCCAAAAGAACTGAAAGCAGG + Intronic
912929407 1:113943614-113943636 TCCCCAAAAGAACTGAAAATAGG - Intronic
914224697 1:145710624-145710646 TACCCAAAAGATTTGAAAACAGG - Intergenic
916184833 1:162120903-162120925 TATCCAAAAGAGATGAACACTGG - Intronic
916732322 1:167577520-167577542 TACTCAAAAGAATTGAATACAGG - Intergenic
917425712 1:174910788-174910810 TACCCAAAATAACTGAAAACAGG - Intronic
917455917 1:175185702-175185724 TGCCCAAAAGAACTGAAAACAGG + Intronic
920283772 1:204864350-204864372 TACCCAAAAGAACTGAAAACAGG - Intronic
920643729 1:207780539-207780561 TACCTAAAAGAACTGAATACGGG - Intronic
921136987 1:212270126-212270148 CCCCAAAAGGAGCTGAATAATGG - Intergenic
921755943 1:218855840-218855862 AACCCAAGAGAGCTGAAGCATGG + Intergenic
921781694 1:219173161-219173183 TACCCAAAAGAGATGAAAGCAGG - Intergenic
922146197 1:222947536-222947558 TACCCAAAAGAACTGAAAGCAGG - Intronic
923476725 1:234340719-234340741 TACCCAGAAGAACTGAAAACAGG + Intergenic
923556654 1:235006173-235006195 TACCCAAAAGAACTGAAAGCAGG + Intergenic
1064196463 10:13247687-13247709 CAACCAAAAGAGCTGGAGAATGG + Intergenic
1064215496 10:13396934-13396956 TACCCAAAAGAATTGAAAACAGG - Intergenic
1064415045 10:15141915-15141937 TACCCAAGAGATCTTGATAATGG - Intronic
1066690812 10:38026221-38026243 TATCCAAAAGAACTGAATACAGG - Intronic
1066698391 10:38099604-38099626 TAACCAAAAGAACTGAAAGAAGG - Intronic
1066994122 10:42547544-42547566 TAACCAAAAGAACTGAAAGAAGG + Intergenic
1068748012 10:60557148-60557170 TACCCAAAAGAACTGGAAACAGG + Intronic
1069397781 10:68008680-68008702 TACCCAAAAGAACTGAAAGCAGG + Intronic
1069970425 10:72163273-72163295 TGCCCAAGAGAACTGAAAAAGGG + Intronic
1070171640 10:73937565-73937587 TACCAAAAAGAGCGGCATAGTGG + Intergenic
1070495801 10:77020913-77020935 TACCTACAAGAGGTGGATAATGG + Intronic
1071399264 10:85253609-85253631 TACACGACAGAGCTTAATAAAGG + Intergenic
1072328633 10:94323454-94323476 TACACAAAAGAAATAAATAAGGG - Intronic
1072336083 10:94399689-94399711 TACCCAAAAGAATTGAAAACAGG - Intergenic
1072595302 10:96866486-96866508 TACCCAAGAGAAATGAATAATGG - Intronic
1072604928 10:96972839-96972861 TCACTAAAAGAGCAGAATAAAGG - Intronic
1072635510 10:97175380-97175402 TACCCAAAAGAACTGAACACAGG - Intronic
1072816441 10:98513908-98513930 TACCCAAAAGACGTGAAAAGAGG + Intronic
1073279087 10:102338839-102338861 AACCAAGAAGATCTGAATAATGG + Intronic
1073723500 10:106202738-106202760 TAACCAAAAGAACACAATAAAGG + Intergenic
1074045633 10:109836095-109836117 TACCCAAGAGAACTGAAAACAGG + Intergenic
1074328999 10:112484458-112484480 TTCACAAAGGAGGTGAATAATGG - Intronic
1074950006 10:118324323-118324345 TACCCAAAAGAACTGAAAGCAGG + Intronic
1077064040 11:631043-631065 TACCCAAAAGAAGTGAAGACAGG - Intergenic
1077361040 11:2140186-2140208 CACCCAAAATATCTGGATAATGG + Exonic
1077528317 11:3082297-3082319 TACCCAAAAGACATGAAAACAGG + Intergenic
1077641159 11:3882641-3882663 TACCCAAAAGAACTGGAAACAGG - Intronic
1078051806 11:7971873-7971895 TACCCAAAGAAGCCAAATAAAGG + Intronic
1078254765 11:9648753-9648775 TACCCAAAAGAATTGAAAATAGG - Intergenic
1078340334 11:10493986-10494008 TACCCAAAAGAACTGAAAGCAGG + Intronic
1079055133 11:17199380-17199402 TACCCAAAAGAACTGAAAATAGG + Intronic
1080448684 11:32360777-32360799 CACCCAAAAGAACTGAAAACAGG - Intergenic
1083117699 11:60479033-60479055 AGCCCAGAAGAGCTAAATAATGG - Intergenic
1083197614 11:61098375-61098397 TTCTCAAAAGAGGGGAATAAGGG + Intergenic
1083840365 11:65301079-65301101 TACCCAAGAGAACTGAAAACAGG - Intronic
1084315939 11:68345655-68345677 TACCCAAAAGAACTGAAAACAGG - Intronic
1086101593 11:83105892-83105914 AACCCAAAAAAGCACAATAAAGG - Intergenic
1088677638 11:112211454-112211476 TACCTAAAAGAACTAAAAAAAGG - Intronic
1090664932 11:128908684-128908706 TTCCCCAAAGAGCTGAGTACAGG + Intronic
1090845485 11:130526684-130526706 TACCCAAAAGAATTGAAAACAGG - Intergenic
1091659371 12:2372015-2372037 AACCCAAAAGAGCTAATTATGGG - Intronic
1091858214 12:3755961-3755983 GACCCAAGTGAGCTGAATACTGG - Intronic
1091983780 12:4890398-4890420 TACCCAAAAGAACTGAAAGTAGG + Intergenic
1092726373 12:11489736-11489758 AACTCAAAAGTGATGAATAAAGG - Intronic
1094571389 12:31644334-31644356 TAACCAAAAGAGCTGAAGGGTGG + Intergenic
1095109576 12:38277855-38277877 TTCCCAAGAGAGCTGATTACTGG + Intergenic
1096133654 12:49181367-49181389 TACCCAAAAAAACTGAAAACAGG + Intergenic
1097037615 12:56134098-56134120 TACCCACCACAGCTGAAGAAGGG + Exonic
1098349830 12:69546879-69546901 TACCCAAAAGAACTGAAGGCAGG + Intronic
1098425327 12:70358508-70358530 TACCTTAAAGAGCTGAAAAGAGG - Intergenic
1099554046 12:84087398-84087420 TACCCAAAAGATTTGAACACAGG - Intergenic
1100297003 12:93272312-93272334 TACCCAAAAGAATTGAATGTAGG + Intergenic
1100483793 12:95005186-95005208 TATCCAAAAGAACTGAAAACAGG - Intergenic
1101419902 12:104542258-104542280 TACCCAAAAGAACTGAAAGCAGG + Intronic
1101488171 12:105186469-105186491 TACCCAAAAGAATTAAATACAGG - Intronic
1102329720 12:112018664-112018686 TACCCAAAAGAGTGGAATACAGG + Intronic
1102706142 12:114882245-114882267 TACCCAAAAGAACTGAAAACAGG - Intergenic
1102812261 12:115834412-115834434 TGCCCACAAGAGCAAAATAAGGG - Intergenic
1103051076 12:117780214-117780236 TACCCAAAAGAATTGAAAGAAGG + Intronic
1103676039 12:122656554-122656576 TGCCCAAAAGAGTTGAAAACAGG - Intergenic
1104082030 12:125437420-125437442 TACCCAAAAGCACTGAAAACAGG - Intronic
1104845254 12:131843733-131843755 CACCCTAAAGAGCTGAAGACAGG - Intronic
1105830030 13:24156169-24156191 TACCCAAAAGAACTGAAAGCAGG - Intronic
1105834338 13:24195439-24195461 TACCCAAGAGAACTGAAAACAGG - Intronic
1105835482 13:24207414-24207436 TACCCAAAAGAACTGAAACTGGG - Intronic
1106162174 13:27211503-27211525 TACCCAAAAGAATTGAAAATAGG + Intergenic
1106198587 13:27515906-27515928 TACCCAAAAGAACTGAAAGCAGG + Intergenic
1106218308 13:27722420-27722442 TTCCCAAAAGAGCTGTGAAATGG - Intergenic
1106579756 13:31007354-31007376 TACCCAAAAGAACTGAAATCAGG + Intergenic
1106731754 13:32548552-32548574 TACCCAAAAGAGTAGAAAACAGG + Intergenic
1107146009 13:37060920-37060942 TACCCAAAAGAATTGAAAACAGG - Intergenic
1107835086 13:44406445-44406467 TCCCCAAAAGAACTGAAAGAGGG + Intergenic
1107889372 13:44900834-44900856 TGCACAACAGATCTGAATAATGG + Intergenic
1108809337 13:54202108-54202130 TAACCAAAACTGCTGGATAATGG + Intergenic
1109703429 13:66057142-66057164 TACTGAAAGGAGATGAATAAAGG + Intergenic
1109836715 13:67868209-67868231 TACCCAAAAGGATTGAATCAAGG + Intergenic
1110590270 13:77248767-77248789 TGCCCAAAAGAACTGAAAACAGG + Intronic
1111334075 13:86798806-86798828 TATCCAAAAGAACTGAAGTAAGG - Intergenic
1111919594 13:94396389-94396411 TACCAAAAAGAAAAGAATAAAGG + Intronic
1112153552 13:96792251-96792273 TACACACTTGAGCTGAATAATGG + Intronic
1112489695 13:99850679-99850701 TACCCAAAAGAATTGAAAAGAGG + Intronic
1112959781 13:105109378-105109400 TAGCTAAAAGAGCTGAAAACTGG - Intergenic
1114922156 14:27345096-27345118 GACCCTCAAGAGCTGAAGAATGG - Intergenic
1115304067 14:31915778-31915800 TACCCAAAAGATCAGGATACGGG - Intergenic
1115365816 14:32555929-32555951 TACCCAAAAGAACTGAAAGCAGG - Intronic
1116380696 14:44264166-44264188 CACCTAGAAGAGATGAATAATGG - Intergenic
1116913389 14:50495565-50495587 TATCCAAAAGAACTGAAAATAGG + Intronic
1117003023 14:51390889-51390911 TACCCAAAAGAGTTGAAAGCAGG + Intergenic
1117210447 14:53492771-53492793 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1117869235 14:60182140-60182162 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1118091903 14:62490605-62490627 TACCCAAAAGACCTGAGAAAAGG - Intergenic
1118447754 14:65867331-65867353 TATCAAAGAGAGCTGAATGAGGG + Intergenic
1118755459 14:68839969-68839991 TACCCAAAAGAATTGAAAGAAGG + Intergenic
1119369440 14:74126387-74126409 TACCCAAAAGAATTGAAAACAGG + Intronic
1121032368 14:90669933-90669955 AACCCAAAAGAACTGAAAAAAGG + Intronic
1121099176 14:91238248-91238270 TACCCAAAAGAACTGAAAGTGGG - Intronic
1121872145 14:97418246-97418268 GACCCTAAAGAGCTGAAAACAGG - Intergenic
1123022895 14:105410536-105410558 TACCCAAAAGAGTTGAAGGCAGG - Intronic
1124142624 15:27090034-27090056 TACACAAAAGAACTGAAAACAGG - Intronic
1124213589 15:27785276-27785298 TACGCAAAAGAACTGAAAACAGG + Intronic
1124406308 15:29395341-29395363 TACCCAAAAGAATTGAAAGAAGG - Intronic
1124411467 15:29440975-29440997 TACCCAAAAGAACAAAAGAAGGG + Intronic
1124701512 15:31917480-31917502 ATCCCAGAAGAGCTGAAAAATGG - Intergenic
1125988440 15:44079614-44079636 TACCCAAAAGAACTGAAAGCAGG + Intronic
1126733110 15:51704812-51704834 TACCCAAAAGAACTGAAAGAAGG - Intronic
1127048877 15:55058735-55058757 TACCCAAAAGAACTGAAAACAGG - Intergenic
1128147701 15:65341382-65341404 TACCCAAAAGAACTGAAAGCAGG + Intronic
1128353156 15:66905523-66905545 TACCCAAAAGAGATGAAAGCTGG - Intergenic
1129526534 15:76219984-76220006 TACCCAAAAGAACTGAAAGCAGG + Intronic
1129627915 15:77224264-77224286 TAACAAAAAGGGCTGAAAAAAGG + Intronic
1130692280 15:86093208-86093230 CACCCAGAAGAGTTGAAGAATGG - Intergenic
1130859175 15:87871301-87871323 TACCCTGAAGAGCTGAATCTTGG - Intronic
1132130259 15:99270759-99270781 TACCCAAAAGAACTGAAAACAGG - Intronic
1132324527 15:100957609-100957631 AAACCAAAAGAGCTAAAGAATGG - Intronic
1132919913 16:2382212-2382234 TACCCAAAATAACTGAAAATAGG - Intergenic
1133065184 16:3201306-3201328 TACCCAAAAGAATTGAAAACAGG - Intergenic
1133083119 16:3339346-3339368 TACCCAAAAGAATTGAAAACAGG - Intergenic
1133157880 16:3888576-3888598 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1133785904 16:8972959-8972981 TACCCAAGAGAACTGAAAACAGG + Intergenic
1133980316 16:10628432-10628454 TACCCAAAAGAACAGAAAACAGG + Intronic
1135253526 16:20921783-20921805 TAGCTAAAAGAGTTGAATATTGG - Intronic
1135511986 16:23093683-23093705 TACCCAAAAGAACTGAAAACAGG + Intronic
1137306194 16:47203004-47203026 TACCCAAAAGAACTGAAAGCAGG + Intronic
1138372323 16:56537012-56537034 TACCCAAAAGAAATGAAAACAGG + Intergenic
1138618363 16:58190882-58190904 TACCCAAAAGAAGTGAAGCAGGG + Intronic
1138723411 16:59109036-59109058 TTCTCAAAAGAGCTGATTAAAGG - Intergenic
1139066133 16:63317086-63317108 TATCTAAAAGAGCTGAAAACAGG - Intergenic
1139403619 16:66701248-66701270 TACCCAAAAGAACTGATAATGGG + Intergenic
1139567424 16:67787533-67787555 CACCCAAAAGAACTGAAAATAGG + Intronic
1139616063 16:68093123-68093145 GACTGAAAAGAGATGAATAAAGG - Intronic
1140053646 16:71505263-71505285 TACCGAAAAGAACTGAAAACAGG + Intronic
1141052460 16:80783500-80783522 CAGCCAAAAGAACTGAATCAAGG + Intronic
1142299736 16:89249384-89249406 TACCCTAAAGAACTGAAAATAGG - Intergenic
1143087966 17:4430825-4430847 TATCCAAAAGAACTGAAAACAGG - Intergenic
1143351858 17:6294583-6294605 TACCCAACAGAACTGAAGACAGG + Intergenic
1143607538 17:7998005-7998027 TACCCAAAACAACTGAAGGAAGG + Intergenic
1143868158 17:9939127-9939149 TACCCAAAAAAACTGAGTACAGG - Intronic
1144668429 17:17117695-17117717 TACCCAAAAGAACAGAAGACAGG - Intronic
1144798484 17:17909254-17909276 TACCCAAAAGAACTGAAAGCAGG + Intronic
1145059842 17:19725547-19725569 TACCCAAAAGAACTGAAAGCAGG + Intergenic
1145221379 17:21092393-21092415 TCCCCAAAACAGCTAAATACAGG - Intergenic
1145889350 17:28404194-28404216 AACCCAAAGAAGCTGACTAAGGG + Intronic
1145987733 17:29058617-29058639 TGCCCAAAAGAACTGAAAACAGG + Intergenic
1146147289 17:30430957-30430979 CACCCAAAAGAACTGAATACAGG - Intronic
1147326244 17:39671095-39671117 CACACAAATGAGCTGAACAAGGG + Intergenic
1148370432 17:47095707-47095729 TACCCAAGAGAACTGAAAAGAGG + Intergenic
1148531970 17:48402272-48402294 TACCCAAAAGAAATGAAAACAGG + Intronic
1148709543 17:49667751-49667773 TACCCAAAAGAACTGAAAGCAGG + Intronic
1148982704 17:51592452-51592474 TACCCAAAAGAGCAGAGTGTTGG - Intergenic
1150535540 17:66035599-66035621 TACCCAAAAGAACTGAAGTCAGG + Intronic
1152153869 17:78620306-78620328 CACCCAAAAGAACTGAAAACTGG + Intergenic
1152882248 17:82824767-82824789 TACCCAAAGGAACTAAAAAAAGG - Intronic
1153450703 18:5224990-5225012 TACTCAAAAGACCTGAAAACAGG + Intergenic
1153798338 18:8646195-8646217 TACCCAAAAGAACCGAAAACAGG + Intergenic
1154001363 18:10484907-10484929 TACCCAAAAGAGTTGAAAGCAGG - Intronic
1154982051 18:21510673-21510695 TACCCAGAAGAGTTGAAATAAGG - Intronic
1155186794 18:23394043-23394065 TACCCAAAAGAACTGAAAGAAGG - Intronic
1156082847 18:33360229-33360251 TACTCAAAAGAACTGAAAACAGG + Intronic
1156114443 18:33770325-33770347 TAGGCCAAAGATCTGAATAAAGG - Intergenic
1156591377 18:38492875-38492897 TACCCAAAAGAATTGAATGCAGG + Intergenic
1156627333 18:38924812-38924834 AACCCAAAAGAGCTGGCTAATGG + Intergenic
1156933015 18:42668143-42668165 TAACAAAAAGACTTGAATAAAGG + Intergenic
1157744500 18:50122973-50122995 TACCCAAAATAACTGAAAATAGG + Intronic
1158465646 18:57687703-57687725 TACTCAAAAGAACTGAAACAGGG - Intronic
1158866345 18:61641121-61641143 TACCCAAAAGAATTGAAAAGAGG + Intergenic
1158968332 18:62643342-62643364 TACCTTTCAGAGCTGAATAATGG + Intergenic
1159575963 18:70177936-70177958 TACCCAAAAGAACTGAAAGCAGG + Intronic
1160215327 18:76924163-76924185 TACACAAAAGAGATAAATACAGG - Intronic
1163238671 19:16044945-16044967 TACCCAAAAGAACTGAAAACAGG + Intergenic
1163359900 19:16839293-16839315 TAACCAAGAGAACTGAAAAAAGG - Intronic
1163361357 19:16848238-16848260 TACCCAAAAGAACTGAAAACAGG - Intronic
1163521129 19:17792753-17792775 TACCCAAAGGAGTTGAAAACAGG - Intergenic
1163650737 19:18516244-18516266 CACCCAGAAGAGCTGAGTACTGG + Intronic
1163682659 19:18692161-18692183 TACTAAAAAGGGCTGAATGAAGG + Intronic
1163812985 19:19445904-19445926 TATCCAAGAGAGCTGAATATAGG - Intronic
1165299004 19:34955685-34955707 TACCCAAAAGAGTTGAAAGTAGG + Intergenic
1165553805 19:36611633-36611655 TACCCAAAAGAACTGAAAGCAGG - Intronic
1167394711 19:49220676-49220698 TACCCAAAAGAACTGAAGACAGG - Intergenic
926947754 2:18206478-18206500 TACCCCAAAGACCTGATTATAGG + Intronic
927644073 2:24864386-24864408 TATCCAAAAGAACTGAAAACAGG + Intronic
927742339 2:25582746-25582768 TACCCAAATAGGCTAAATAAAGG + Intronic
927807062 2:26157363-26157385 TACCCAGAAGAACTGAAAACAGG + Intergenic
927824003 2:26294760-26294782 TACCCAAAAGAACTGAAAGCAGG + Intergenic
928040901 2:27876140-27876162 TACTCAAAAGAACTGAAAACAGG + Intronic
928555857 2:32424445-32424467 TACCCAAAACAACTGAAAACGGG - Intronic
928700694 2:33895797-33895819 TACTGTAAAGGGCTGAATAATGG + Intergenic
929121188 2:38485220-38485242 TACCCAAAGGAACTGAAAACAGG + Intergenic
929761675 2:44812240-44812262 TACCCAAAAGAACAGAAAACAGG - Intergenic
929869645 2:45747691-45747713 TACCCAAAAGAACTGAAGCAGGG - Intronic
930049308 2:47202124-47202146 TACCCAAAAGAATTGAAAATAGG + Intergenic
931281640 2:60799002-60799024 ATCCCAAAACATCTGAATAAAGG - Intronic
931632339 2:64312329-64312351 TTCCCACAACAGCTAAATAAGGG - Intergenic
932908082 2:75775879-75775901 TTCCCAAAAAAGCTTAACAAAGG + Intergenic
933154923 2:78962911-78962933 TGCCCAGAAGAGCTGGAAAATGG + Intergenic
934875070 2:97910383-97910405 TACCCTAAAGAACTGAAAACAGG + Intronic
935175990 2:100649085-100649107 GACCCTTAAGAGCTGAGTAAAGG + Intergenic
935747048 2:106197643-106197665 TACCCAAAAGAACTGAAAGTGGG - Intergenic
936602014 2:113905984-113906006 TACCCAAAAGAACTGAAAGCAGG - Intronic
937358848 2:121214968-121214990 TACCCAAAAGAACTGAAAGCAGG + Intergenic
938859067 2:135347580-135347602 TACCCAAGAGAACTGAAAACAGG - Intronic
939289585 2:140176632-140176654 CACCCAAAGAATCTGAATAAAGG + Intergenic
939316542 2:140557842-140557864 TACAAAGGAGAGCTGAATAAGGG - Intronic
939659750 2:144873588-144873610 TATTCAAAAGATCAGAATAAAGG - Intergenic
939767195 2:146265689-146265711 TTCCCAAAACAGCCCAATAAAGG - Intergenic
940766456 2:157795227-157795249 AATCCAAAAGAGATAAATAATGG - Intronic
940912659 2:159222725-159222747 TACCCCAAAGAACTGAAAACAGG - Intronic
941077990 2:161028083-161028105 TACCCAAAGGAACTGAAAACAGG - Intergenic
941088690 2:161148010-161148032 TACCCAAAAGAACTGAAAACAGG - Intronic
941109480 2:161403046-161403068 TACCCAAAAGAATTGAAAATAGG + Intronic
941200756 2:162506301-162506323 TTCCAAAAAGACCTGAAGAACGG - Intronic
942018486 2:171842030-171842052 TAGCCAAAAGAACTGAAAACAGG + Intronic
942235095 2:173896155-173896177 TACCCAAAAGAATTGAAAACAGG + Intergenic
942719217 2:178931325-178931347 TACCCAAAAGAATTGAAAAGAGG + Intronic
942825090 2:180165970-180165992 TAACCATAAAAGATGAATAATGG + Intergenic
944464096 2:199982946-199982968 AACCCACAAGAGCTGATTAAAGG - Intronic
944477572 2:200123436-200123458 TATCCAAAAGAACTGAAAACAGG + Intergenic
945747827 2:213740432-213740454 TACCAAAAAGAGGTGAGTGAAGG + Intronic
945944446 2:215981159-215981181 TGCCCAAAAGAACTGAAAACAGG + Intronic
945998828 2:216463717-216463739 TACCAAGAACACCTGAATAATGG + Intronic
947862529 2:233371054-233371076 TACCCAAAAGAAATGAAAACAGG - Intronic
948049805 2:234971477-234971499 TACCCAAAAGAGCTGAGAGCAGG - Intronic
948200894 2:236129083-236129105 TTCCCCAAAAAGCTAAATAAGGG + Exonic
948475841 2:238218585-238218607 TACCCAAAAGAATTGAAAATGGG - Intergenic
948585584 2:239016795-239016817 CACAACAAAGAGCTGAATAAAGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1169200917 20:3709579-3709601 TACCCAAAAGTACTGAAAACAGG + Intergenic
1169347745 20:4842251-4842273 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1169385302 20:5144064-5144086 TACCCAAAAGAACTGAAAGCAGG - Intronic
1170119540 20:12896403-12896425 TACCCAAAACAACAGAAAAAGGG - Intergenic
1170301365 20:14887879-14887901 TAAACAAAAGAGCTGAACACAGG - Intronic
1170557502 20:17526653-17526675 TACCCAAAAGAATTGAAAGAGGG - Intronic
1170593488 20:17788515-17788537 TACTCAAAAGAGTTGAAAACTGG - Intergenic
1171214709 20:23343909-23343931 TACCCAAAAGAATTGAAAATAGG - Intergenic
1172452546 20:35037419-35037441 TACCCAAAAGAATTGAAAACAGG + Intronic
1172865879 20:38096898-38096920 TACCCAACAGAACTGAAAACAGG - Intronic
1173782604 20:45769093-45769115 TACCCAAAAGAACTAAAAACAGG - Intronic
1175505261 20:59478944-59478966 TACCCAAAAGAGGTGAAAGCAGG - Intergenic
1176134205 20:63513416-63513438 GACCCAAAAGAGTTGAAAACAGG + Intergenic
1176149575 20:63583024-63583046 TACCCAAGAGAAATGAAAAAAGG + Intergenic
1176926827 21:14760366-14760388 TATCCAAAAGAGCTGAAATCAGG + Intergenic
1177282231 21:18995428-18995450 TATCCAAAAGAGCTGTGTATGGG + Intergenic
1177834772 21:26175919-26175941 TACCTAACAGACCTGAATATAGG + Intergenic
1178848801 21:36196035-36196057 TACTCAAAAGAGCAGAAGAAAGG + Intronic
1179575595 21:42306514-42306536 TACCCAAAAGAGGTGACTCTTGG + Intergenic
1180873596 22:19162764-19162786 TACCCAGAAGGGCTGAATGCAGG - Intergenic
1181491632 22:23263880-23263902 GTCACAAAAGAGCTGAGTAATGG - Intronic
1181581360 22:23830079-23830101 TACTCACAATAGCTGAAAAATGG - Intronic
1181662042 22:24358533-24358555 TGCTCCAAAGAGCTGAATTATGG - Intronic
1181984325 22:26789124-26789146 TACCCCAAAGAACTGAAAACAGG - Intergenic
1182127001 22:27823150-27823172 AACCCAAAAGAACTGAAAACAGG + Intergenic
1182669303 22:31982541-31982563 TACCCAAAAGAATTGAAAACAGG - Intergenic
1182669307 22:31982598-31982620 TACCCAAAAGAATTGAAAACAGG - Intergenic
1182669311 22:31982655-31982677 TACCCAAAAGAATTGAAAACAGG - Intergenic
1183158486 22:36093959-36093981 TACCCAAAAGAGCTGAAAGCAGG - Intergenic
1183897287 22:40979419-40979441 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1184738763 22:46414787-46414809 TACCCAAAAGAACTGAAAACAGG + Intronic
1185252070 22:49808187-49808209 CACCCAAAAGAACTGAAAACAGG + Intronic
1185302843 22:50091606-50091628 TACCCAAGAGAGCTGCTGAAGGG - Intronic
949535256 3:4990404-4990426 TACCCAAAAGAATTGAAAACAGG + Intergenic
949637199 3:5995910-5995932 TATCCAAAAGGGCTGAAGAGAGG - Intergenic
949878147 3:8640486-8640508 TACCCACAAGAGAGGAAGAAAGG + Intronic
950065623 3:10109238-10109260 TACCCAAAAAACCAGAACAAAGG - Intergenic
950300784 3:11876239-11876261 TACCCTAAAGAACTGAAAACAGG - Intergenic
950616407 3:14163257-14163279 TACCCAAAAGAACAGAAAACAGG + Intronic
950907101 3:16548979-16549001 TACCCAAAAGAATTGAAAACAGG + Intergenic
951064270 3:18246233-18246255 TACCCAAAATAACTGAAAACAGG - Intronic
951444407 3:22761542-22761564 ATCCTAAAAGATCTGAATAAAGG + Intergenic
951966756 3:28395412-28395434 TATCCAAAAGAACTGAAAACAGG + Intronic
951969064 3:28422704-28422726 TACCCAAAGGAACTGAAAACAGG - Intronic
952719604 3:36518724-36518746 TACCCCAAAGAGATGAATTCAGG - Intronic
952804866 3:37339386-37339408 TACCCAAAAGAACTGGAAACAGG - Intronic
953408727 3:42675506-42675528 TACCCAAAAGAACTGAAAGCAGG - Intergenic
954311117 3:49768195-49768217 TACCCAAAAGAACTGAAAGGAGG + Intronic
954591086 3:51782534-51782556 TACCCAAAAGAATTGAAAACAGG - Intergenic
954741963 3:52759750-52759772 TACCCAAAAGAACGGAAAACAGG + Intronic
954889841 3:53915394-53915416 TACCCAAAAGAACTGAAAACAGG - Intergenic
955035106 3:55260151-55260173 TACCTAAATGATCTGAATCAGGG - Intergenic
955199041 3:56833078-56833100 TACCCAAAAGAACTGAAAACAGG - Intronic
955682534 3:61517325-61517347 TACCCAAAAGAATTGAAAACAGG + Intergenic
957187031 3:76955346-76955368 TACCCAAAAGAACTGAAAAGAGG - Intronic
957421048 3:79970445-79970467 TACCCAAAAGAAAGGAAGAAAGG + Intergenic
958966682 3:100566254-100566276 TACCCAAAAGAACTAAAAATAGG - Intronic
959040986 3:101423555-101423577 TACCCAAAAGAAATGAAAACAGG + Intronic
959400608 3:105897262-105897284 TACCCAAACATGTTGAATAATGG - Intergenic
959437271 3:106331666-106331688 TACTCCAAAGAGATAAATAAGGG - Intergenic
960144269 3:114182980-114183002 TATCTAAAAGAGCTGAAAACAGG - Intronic
960960334 3:123066499-123066521 TACCCAAAAGAATTGAAAACAGG - Intergenic
961529393 3:127531261-127531283 TACCCAAAAGGAGTGATTAAAGG + Intergenic
962784816 3:138757914-138757936 TACCCAAAAGAACTGAAAGCAGG + Intronic
963067586 3:141275510-141275532 TTCACAAAAGAGCAGAATCAAGG + Intronic
964924745 3:161941634-161941656 CACCAGAAAGAGCTGCATAAGGG - Intergenic
966091302 3:176142024-176142046 TACCCAAAAGAACTGAAAGCAGG + Intergenic
966155096 3:176907545-176907567 TTCCTAAAAGAGCTAAAAAAGGG - Intergenic
966229637 3:177637872-177637894 AACCCAAACCAGCAGAATAAAGG - Intergenic
967127112 3:186434566-186434588 TACCCCAAAGAGCTGCAAACAGG - Intergenic
967525443 3:190487407-190487429 TGCCCAAGAGAGCTGAAAATAGG - Intergenic
967780166 3:193429301-193429323 TACCCAAAAGAGTTGAAAACAGG + Intronic
968020290 3:195380144-195380166 TGCCCAAAAGAACTGAAAACAGG + Intronic
968152423 3:196347471-196347493 TACCACAAAGAGCAGAAAAAAGG + Intergenic
968560443 4:1278232-1278254 TACCCCAAAGAGCTGAAAATTGG - Intergenic
968856625 4:3129398-3129420 TACCTAAAAAAACTGAACAATGG - Intronic
969128908 4:4976089-4976111 TACCCAAAAGAGGTGAAAGCAGG - Intergenic
969430973 4:7154194-7154216 TACCAGATAGAGCTGAATACGGG - Intergenic
969904379 4:10380430-10380452 TACACAATAGAGCAGAAGAAGGG - Intergenic
971131034 4:23811237-23811259 TATATAAAAGAGCTGACTAATGG - Intronic
971288827 4:25316313-25316335 TACCCAAAAGAATTGAAGACAGG - Intronic
971837775 4:31791140-31791162 TACACAAAACAGCTGAAATAGGG + Intergenic
972928580 4:44041813-44041835 TCCCCAAATGAACTAAATAAAGG + Intergenic
975369341 4:73567240-73567262 TCCCCAAATGAACTAAATAAGGG - Intergenic
976798931 4:88966040-88966062 TATCCAAAAGAGTTGAAAGAAGG - Intronic
977927884 4:102721424-102721446 TATCCAAAAGAACTGAAAGAAGG + Intronic
977934812 4:102789482-102789504 TACCCAAAACAACTGAAAACAGG - Intergenic
979456141 4:120927912-120927934 AACCCAAGAGAGCTGAGTCATGG + Intergenic
981056826 4:140371765-140371787 TATCCAAAAGAACTGAAAAGAGG + Intronic
981464721 4:145055094-145055116 TACCCAAAAGAGCTGAATAAAGG + Intronic
981933873 4:150218487-150218509 TACCCAAATTAGCTCAAGAAAGG + Intronic
982639521 4:157940647-157940669 TACCCAAAAGAACTGAAAGCAGG + Intergenic
982649966 4:158075906-158075928 TAGCCAAAACAACTGAAAAAAGG - Intergenic
986852087 5:11825347-11825369 AGCACAAAAGAGCTGAAAAAAGG + Intronic
989242178 5:39214393-39214415 TACCCAAAAGAACTGAAAGCAGG + Intronic
989365296 5:40649244-40649266 TACCCAAATGATTTGAATATAGG + Intergenic
990665837 5:58070279-58070301 TACCCAACTGACCTGAAGAAAGG + Intergenic
990674778 5:58171609-58171631 CAGCCAAAAGACCTGAGTAATGG - Intergenic
991232830 5:64356504-64356526 TACCCAAAAGAATTGAAAACAGG + Intronic
991983983 5:72263900-72263922 TACCCAAAAGAACTAAAAATAGG + Intronic
992032874 5:72740890-72740912 TACCCAAAAGAATTGAAAACAGG - Intergenic
992306233 5:75441892-75441914 TACCCAAAAGAAATGAAAGAGGG - Intronic
992795249 5:80250065-80250087 TAACCAAAAGAGCTCAACAGGGG + Intronic
993141320 5:84037711-84037733 TTCCCCTAAGAGTTGAATAACGG + Intronic
994018311 5:94994435-94994457 TAGCCAAAAGATCTCAGTAAAGG - Intronic
994650996 5:102528229-102528251 TACTCAAAAGAGTTAAAAAATGG - Intergenic
995102102 5:108324591-108324613 TACCCCAAAGAACTGAAAGAAGG + Intronic
995906382 5:117128955-117128977 TACCCAAAAGAGCTGGTTGTGGG + Intergenic
996175271 5:120348805-120348827 TACACAAAAGAGCAAAATGAAGG - Intergenic
996429795 5:123361090-123361112 TACCCAAATCAGCTGAAAAGGGG - Intronic
996846701 5:127906825-127906847 TACCCAAAAGAACTGAAAGGAGG - Intergenic
996930047 5:128875327-128875349 TACCCAAAAGAATTGAAAACAGG + Intronic
997418195 5:133745324-133745346 CAGGCAAAACAGCTGAATAAGGG + Intergenic
997477883 5:134157766-134157788 TACCTAAAAGAGATGGATATAGG + Exonic
997675142 5:135707161-135707183 TGCCCAACAGAAGTGAATAAAGG - Intergenic
998332009 5:141337275-141337297 TACCCAAAAGAAGTGAAAATAGG + Intronic
998544859 5:143018673-143018695 TACACAAAAAACCTGAATAAAGG - Intronic
998937411 5:147244366-147244388 TACCCAAAAGAATTGAAAACAGG - Intronic
999273860 5:150315225-150315247 TACCCAAAAAAGTTGAAAACAGG + Intronic
999936223 5:156488215-156488237 TTCCCAAAGGAGCTGGACAATGG + Intronic
1000293142 5:159889954-159889976 TATCCAAAAGAAATGAACAATGG + Intergenic
1000625200 5:163530174-163530196 TACCCAAAAGAGCTGAATTTTGG - Intergenic
1002075531 5:176706112-176706134 TATCCAAGACAGCTGGATAAAGG + Intergenic
1002165644 5:177343428-177343450 TACCCAAAAGAACTGAAAGTAGG + Intronic
1002947598 6:1778127-1778149 TTCCTTAAAGAGCTGAATAAAGG + Intronic
1003091789 6:3110115-3110137 TACCCAAAAGAACTAAAACAGGG - Intronic
1003607399 6:7575735-7575757 GACACAAAAGAGCTGGCTAAAGG - Intronic
1004183632 6:13402832-13402854 TAGCCAAAAGAAATGAAGAAAGG + Intronic
1004226865 6:13793272-13793294 TACCCAAAAGAACTGAAAGCAGG + Intronic
1004308069 6:14519251-14519273 TCCCTAAAATAGCTGAATGAAGG - Intergenic
1004386715 6:15179313-15179335 TACCCAAAAGAACTGAAAGTAGG - Intergenic
1004735194 6:18398791-18398813 TACCCAAAAGAACTGAAAGCAGG - Intronic
1004964911 6:20837516-20837538 CAACCAAAAAACCTGAATAATGG - Intronic
1005241353 6:23832998-23833020 TATCAAAAATAGCTGGATAATGG + Intergenic
1005388178 6:25306783-25306805 TACTCAAAAGAACTGAAAGAAGG - Intronic
1005401891 6:25443167-25443189 TACCTAATTGAGTTGAATAATGG + Intronic
1005426083 6:25704036-25704058 TACACAAAAGAACTGAAAACAGG - Intergenic
1006534573 6:34687929-34687951 TACCCAAAGGAACTAAAAAAAGG + Intronic
1007565215 6:42844995-42845017 CATTCAAAAGAGCTGACTAAAGG + Intronic
1010047235 6:71459527-71459549 AACCCAACAGAGGGGAATAAAGG - Intergenic
1010609491 6:77936301-77936323 TACCACAAGGAGATGAATAAAGG - Intergenic
1010676164 6:78746030-78746052 TATCCAAAAGAATTGAATACAGG + Intergenic
1011359004 6:86501897-86501919 TACACAAAAGAGCCTAAAAAGGG - Intergenic
1012575462 6:100791482-100791504 TACCCAAAACAGCTCTATTAAGG + Intronic
1014205038 6:118648301-118648323 TACTCCAAAAAGCTGAAAAATGG + Intronic
1015083525 6:129258258-129258280 TATCCAAAAGAACTGAAAATAGG + Intronic
1015244980 6:131064957-131064979 TAGCCTAAAGAGATGATTAAAGG + Intergenic
1015765775 6:136714691-136714713 TACCCAAAAGAACTGAAAGCGGG - Intronic
1016366084 6:143320361-143320383 TACCCAAAAGAGTTGAAATCAGG + Intronic
1017147569 6:151248480-151248502 TAGGCGTAAGAGCTGAATAAGGG + Intronic
1018537160 6:164833433-164833455 AACCCAGAAGATCTGAATATAGG - Intergenic
1018970144 6:168522353-168522375 TACCCAAAAGACTTGAAAACAGG + Intronic
1020228662 7:6300018-6300040 TACCCAAAAGAGCAGGAAACAGG + Intergenic
1021141803 7:17034673-17034695 GCCCCAAAAGAGCTGGATATTGG - Intergenic
1021436343 7:20620896-20620918 TACCCAAAAGAACTGAAACGAGG + Intronic
1021561258 7:21970855-21970877 TATGTAAAAGATCTGAATAAAGG + Intergenic
1022281346 7:28913427-28913449 TATCCAAAAGAACTGAAAGAAGG + Intergenic
1022374419 7:29800419-29800441 TACCCAAAAGATTTGAACACAGG - Intergenic
1022770094 7:33461216-33461238 TACCCAAAAGAACTGAATACAGG - Intronic
1023218947 7:37898375-37898397 TTCCCAAAAGAACTGAAAACAGG + Intronic
1023615063 7:42011416-42011438 TACCCAAAAGAACTGAAAACAGG + Intronic
1024519116 7:50287235-50287257 TACCCAAATGAACTGAAAACTGG - Intergenic
1026657840 7:72272822-72272844 TCCCCAAATGAGCTTAAAAAAGG - Intronic
1027740366 7:81995400-81995422 TACCAAAAAAATCTAAATAAAGG + Intronic
1029839479 7:103346984-103347006 TATCCAAAAGAACTGAAAACAGG - Intronic
1030233528 7:107233601-107233623 TAACAAAAAGAGCTCAAGAAGGG - Intronic
1031361689 7:120856695-120856717 TACCCAAAAGAGCAGATTGAGGG + Exonic
1031438388 7:121761828-121761850 TACCCAAAAGAACTGAAAACAGG + Intergenic
1032041799 7:128569213-128569235 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
1032221314 7:129996484-129996506 TACCCAAAAGAACTGAAAGCAGG - Intergenic
1032446549 7:131989075-131989097 TACCCAAAAGAATTGAATGCAGG + Intergenic
1033349375 7:140549747-140549769 TACCCAAAAGAATTGAAGCAGGG + Intronic
1033549058 7:142429119-142429141 TACCCAAAAGAATTGAAAACAGG - Intergenic
1034261148 7:149756543-149756565 TACCCAAAAGAGCTGAAAACAGG + Intergenic
1035646420 8:1225087-1225109 TGCCCAAAAGAGCTGGAAATAGG + Intergenic
1037478097 8:19277479-19277501 TACGAAAAAGAGTTCAATAATGG + Intergenic
1038357717 8:26845587-26845609 TACCTAAAAGAACTGAAAACTGG + Intronic
1039163639 8:34651059-34651081 TACTGAAAATAACTGAATAAGGG - Intergenic
1039535749 8:38310812-38310834 TACCCAAAAGAACTGAAAGAAGG - Intronic
1040525158 8:48216238-48216260 TACCCAAAAGAACTGAAAGTAGG + Intergenic
1040808280 8:51420347-51420369 AACCCAAATTAGCAGAATAAGGG - Intronic
1040921196 8:52619953-52619975 TACCCAAAAGAATTGAAAACAGG + Intergenic
1041059953 8:54025666-54025688 CACCCAAAAGAACTGAAAACAGG - Intergenic
1041142037 8:54831191-54831213 TACCCAAAAGAATTGAAAACAGG - Intergenic
1041206327 8:55501815-55501837 TACCCAAAAGAACTGAAAGCAGG - Intronic
1042204585 8:66316217-66316239 TACCCAAAAGAATTGAAAACAGG + Intergenic
1042266919 8:66917893-66917915 TACCCAAAAGAACTGAAAGCAGG - Intronic
1042574439 8:70202343-70202365 TACCCAAAAGAATTGAAAACAGG + Intronic
1042609309 8:70579705-70579727 TACAGAAGAGAACTGAATAAAGG + Intronic
1042811052 8:72825382-72825404 TACCCAAAAGAACTGAAAACAGG - Intronic
1042864688 8:73346839-73346861 TACCCAAAAGAACTGAAAACAGG + Intergenic
1043029308 8:75112313-75112335 TACCCAAAAGAACTAGATAAAGG - Intergenic
1044603363 8:94027418-94027440 TACCCAAAAGAACTGAAAGCCGG - Intergenic
1044853229 8:96449305-96449327 TTCCCAAAAGAACTGAAAATAGG + Intergenic
1045431504 8:102119076-102119098 TACCCAGAAGAACTGAAAACAGG + Intronic
1045485145 8:102625354-102625376 TACCCAAAAGAATTGAAAACAGG - Intergenic
1045654098 8:104369065-104369087 TTCCCAAAAGAACTGAAAACAGG - Intronic
1046882660 8:119327070-119327092 CAACCAAAATAGCTGAATAAAGG - Intergenic
1047260038 8:123247865-123247887 TACTCAAAAGAACTGAAAATGGG + Intronic
1047355517 8:124118141-124118163 TCCCCAAAAGTGCCGAATGAAGG + Intronic
1048050743 8:130813714-130813736 TACCCAAAATAATTGAAAAAAGG - Intronic
1049011227 8:139888950-139888972 TACCCAAAAGAACTGAAAGCAGG + Intronic
1051463647 9:17353047-17353069 TACCCAAAAGAACTGGAAACAGG - Intronic
1051798523 9:20904244-20904266 TACCCAAAAGAACTGAAAACAGG - Intronic
1053026911 9:34737525-34737547 TACCCAAGAGAACTGAAAACGGG - Intergenic
1053444217 9:38139218-38139240 TACCCAAAAGAGTTGAAAGCAGG - Intergenic
1055007233 9:71521987-71522009 TACCCAAAAGAACTGAAACTAGG + Intergenic
1056163833 9:83923032-83923054 TACCTAAAAGACCTGAAAACAGG - Intergenic
1056890828 9:90490410-90490432 TACCCAAAAGAACTGAAAATGGG + Intergenic
1057115823 9:92520612-92520634 TACCCAAAAGAATTGAAAATAGG + Intronic
1057246264 9:93457229-93457251 TACCCAAAAGAACTGAAAGCAGG - Intronic
1057260943 9:93583398-93583420 TATCCAAAAGAACTGAAAACAGG - Intronic
1057932380 9:99206026-99206048 TAACCAAAACAGCTGAGTATTGG - Intergenic
1059679642 9:116573487-116573509 TTCACAAAAGATATGAATAATGG + Intronic
1060032030 9:120222921-120222943 TACCCAAAAGAGTTGAAATTGGG + Intergenic
1061527755 9:131181344-131181366 TACCCAAAAGAACTGAAAGCAGG - Intronic
1186209001 X:7230357-7230379 TACCCAAAAGAATTGAAAATGGG + Intronic
1186209082 X:7231020-7231042 TACCCAAAAGAATTGAAAACAGG + Intronic
1186347982 X:8713963-8713985 TACCTGTAAGAGCTGAATAAGGG - Intronic
1186683056 X:11896114-11896136 TAGCCTAAAGAGCTCAAGAAGGG - Intergenic
1186902467 X:14071880-14071902 TACCCAAGAGAACTGAAAAAAGG - Intergenic
1186970426 X:14835927-14835949 TATCCAAAAGAACTGAAAATAGG + Intergenic
1187440546 X:19314031-19314053 TACCCAAAAGATCTGAAAATAGG + Intergenic
1187740168 X:22347098-22347120 TACCCAAAAGAACTGAAAACAGG - Intergenic
1187772233 X:22712896-22712918 TACCCAAAAGAACTGAAATCAGG + Intergenic
1187909525 X:24098224-24098246 TACCCAAAAGAATTGAAAACAGG - Intergenic
1188661474 X:32764772-32764794 TACTCAAAAGAATTGAAAAAAGG - Intronic
1189088474 X:38051970-38051992 TACTCATTAGAACTGAATAATGG + Intronic
1189254592 X:39627989-39628011 TACCCAAAAGAACTGAAGGCAGG + Intergenic
1189904127 X:45740544-45740566 TACCCAAAAGAATTGAAAACAGG - Intergenic
1192123683 X:68480733-68480755 TACTCATAATAGCTGAAAAATGG + Intergenic
1193354716 X:80504985-80505007 TAGCCAAAACAGCATAATAATGG + Intergenic
1193923784 X:87461751-87461773 TTCCCAAAGGAACTGAACAATGG - Intergenic
1194902109 X:99525066-99525088 TAGGCAAAAGACATGAATAAAGG + Intergenic
1196749627 X:119103601-119103623 TACCCAAAAGAATTGAAAACAGG + Intronic
1196967194 X:121069283-121069305 TACCCAAAAGAACTGAAAACAGG - Intergenic
1197550193 X:127883247-127883269 AACCCAAATGAGTAGAATAAAGG + Intergenic
1197764197 X:130049134-130049156 TACCCAAAAGAACTAAAAACAGG - Intronic
1199242318 X:145561747-145561769 CACCCAAAAGAACTGAATTTGGG - Intergenic
1199767466 X:150951791-150951813 TACCCAAAAGAACTGAAAACAGG - Intergenic
1200224020 X:154406894-154406916 TACCCAAAAGAACTGAAAGCAGG - Intronic
1202273423 Y:23092257-23092279 TACCCAAAAGAATTGAAAACAGG + Intergenic
1202292603 Y:23328425-23328447 TACCCAAAAGAATTGAAAACAGG - Intergenic
1202426420 Y:24726001-24726023 TACCCAAAAGAATTGAAAACAGG + Intergenic
1202444369 Y:24944085-24944107 TACCCAAAAGAATTGAAAACAGG - Intergenic