ID: 981478316

View in Genome Browser
Species Human (GRCh38)
Location 4:145210369-145210391
Sequence CAGGGTATCCCATGTTTACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981478316_981478321 10 Left 981478316 4:145210369-145210391 CCTAGTAAACATGGGATACCCTG No data
Right 981478321 4:145210402-145210424 AGGTATGCCAGCAAAGTCCCAGG No data
981478316_981478318 -10 Left 981478316 4:145210369-145210391 CCTAGTAAACATGGGATACCCTG No data
Right 981478318 4:145210382-145210404 GGATACCCTGTCATTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981478316 Original CRISPR CAGGGTATCCCATGTTTACT AGG (reversed) Intergenic
No off target data available for this crispr