ID: 981479982

View in Genome Browser
Species Human (GRCh38)
Location 4:145228589-145228611
Sequence TTCTCCCAGCATGGCCTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981479982_981479985 4 Left 981479982 4:145228589-145228611 CCTCAAAGGCCATGCTGGGAGAA No data
Right 981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981479982 Original CRISPR TTCTCCCAGCATGGCCTTTG AGG (reversed) Intergenic
No off target data available for this crispr