ID: 981479983

View in Genome Browser
Species Human (GRCh38)
Location 4:145228598-145228620
Sequence GAGCAGTGGTTCTCCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2300
Summary {0: 354, 1: 791, 2: 515, 3: 258, 4: 382}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981479983_981479985 -5 Left 981479983 4:145228598-145228620 CCATGCTGGGAGAACCACTGCTC 0: 354
1: 791
2: 515
3: 258
4: 382
Right 981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981479983 Original CRISPR GAGCAGTGGTTCTCCCAGCA TGG (reversed) Intergenic
Too many off-targets to display for this crispr