ID: 981479985

View in Genome Browser
Species Human (GRCh38)
Location 4:145228616-145228638
Sequence TGCTCTCTTCAGAGCACAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981479983_981479985 -5 Left 981479983 4:145228598-145228620 CCATGCTGGGAGAACCACTGCTC 0: 354
1: 791
2: 515
3: 258
4: 382
Right 981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG No data
981479982_981479985 4 Left 981479982 4:145228589-145228611 CCTCAAAGGCCATGCTGGGAGAA No data
Right 981479985 4:145228616-145228638 TGCTCTCTTCAGAGCACAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981479985 Original CRISPR TGCTCTCTTCAGAGCACAGT TGG Intergenic
No off target data available for this crispr