ID: 981484388

View in Genome Browser
Species Human (GRCh38)
Location 4:145270112-145270134
Sequence CCTTCAAAGGGGTTTGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 87}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981484382_981484388 -5 Left 981484382 4:145270094-145270116 CCCTTTGCATGTGAAGTGCCTTC 0: 1
1: 0
2: 1
3: 18
4: 224
Right 981484388 4:145270112-145270134 CCTTCAAAGGGGTTTGCCTTAGG 0: 1
1: 0
2: 3
3: 15
4: 87
981484381_981484388 18 Left 981484381 4:145270071-145270093 CCTCTACTTTTTCTAGCACAATT 0: 1
1: 0
2: 3
3: 14
4: 235
Right 981484388 4:145270112-145270134 CCTTCAAAGGGGTTTGCCTTAGG 0: 1
1: 0
2: 3
3: 15
4: 87
981484383_981484388 -6 Left 981484383 4:145270095-145270117 CCTTTGCATGTGAAGTGCCTTCA 0: 1
1: 0
2: 3
3: 21
4: 208
Right 981484388 4:145270112-145270134 CCTTCAAAGGGGTTTGCCTTAGG 0: 1
1: 0
2: 3
3: 15
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981484388 Original CRISPR CCTTCAAAGGGGTTTGCCTT AGG Intergenic