ID: 981485996

View in Genome Browser
Species Human (GRCh38)
Location 4:145286768-145286790
Sequence CTCATTGTGGTTCTTCCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981485996_981485999 14 Left 981485996 4:145286768-145286790 CCAAAGGGAAGAACCACAATGAG No data
Right 981485999 4:145286805-145286827 GAAAAGTTCTTGATACTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981485996 Original CRISPR CTCATTGTGGTTCTTCCCTT TGG (reversed) Intergenic
No off target data available for this crispr