ID: 981489615

View in Genome Browser
Species Human (GRCh38)
Location 4:145325615-145325637
Sequence TTCTGGACTCCACTTATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981489611_981489615 -6 Left 981489611 4:145325598-145325620 CCATCTATAGTAAGTCTTTCTGG No data
Right 981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG No data
981489607_981489615 24 Left 981489607 4:145325568-145325590 CCTCACAGTAATGCAAGCCCACA No data
Right 981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG No data
981489610_981489615 6 Left 981489610 4:145325586-145325608 CCACAGGTGACACCATCTATAGT No data
Right 981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG No data
981489609_981489615 7 Left 981489609 4:145325585-145325607 CCCACAGGTGACACCATCTATAG No data
Right 981489615 4:145325615-145325637 TTCTGGACTCCACTTATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981489615 Original CRISPR TTCTGGACTCCACTTATGGT GGG Intergenic
No off target data available for this crispr