ID: 981492892

View in Genome Browser
Species Human (GRCh38)
Location 4:145359550-145359572
Sequence CACTGGACAAGTTCCCATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981492890_981492892 10 Left 981492890 4:145359517-145359539 CCAAAAACTGAAACTATCTAATT No data
Right 981492892 4:145359550-145359572 CACTGGACAAGTTCCCATTAAGG No data
981492889_981492892 14 Left 981492889 4:145359513-145359535 CCTTCCAAAAACTGAAACTATCT No data
Right 981492892 4:145359550-145359572 CACTGGACAAGTTCCCATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981492892 Original CRISPR CACTGGACAAGTTCCCATTA AGG Intergenic
No off target data available for this crispr