ID: 981496971

View in Genome Browser
Species Human (GRCh38)
Location 4:145404893-145404915
Sequence GATTGAAGCCATTTAGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981496968_981496971 -5 Left 981496968 4:145404875-145404897 CCTTGGACCGTGTTCACAGATTG No data
Right 981496971 4:145404893-145404915 GATTGAAGCCATTTAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981496971 Original CRISPR GATTGAAGCCATTTAGCACA GGG Intergenic
No off target data available for this crispr