ID: 981498523

View in Genome Browser
Species Human (GRCh38)
Location 4:145420852-145420874
Sequence CAACAACCTGAAGCAACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981498523_981498528 7 Left 981498523 4:145420852-145420874 CCCCAGGTTGCTTCAGGTTGTTG No data
Right 981498528 4:145420882-145420904 TCCACACAGTTGTAGGACTGAGG No data
981498523_981498530 25 Left 981498523 4:145420852-145420874 CCCCAGGTTGCTTCAGGTTGTTG No data
Right 981498530 4:145420900-145420922 TGAGGTCCCCATTTCCTTGCTGG No data
981498523_981498527 0 Left 981498523 4:145420852-145420874 CCCCAGGTTGCTTCAGGTTGTTG No data
Right 981498527 4:145420875-145420897 GCAGAATTCCACACAGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981498523 Original CRISPR CAACAACCTGAAGCAACCTG GGG (reversed) Intergenic
No off target data available for this crispr