ID: 981500445

View in Genome Browser
Species Human (GRCh38)
Location 4:145445659-145445681
Sequence AAGCAGCCATCCGTGAGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981500445_981500450 27 Left 981500445 4:145445659-145445681 CCTTGACTCACGGATGGCTGCTT No data
Right 981500450 4:145445709-145445731 TCTCTATACACATGCATCCCTGG No data
981500445_981500446 -1 Left 981500445 4:145445659-145445681 CCTTGACTCACGGATGGCTGCTT No data
Right 981500446 4:145445681-145445703 TTTTTTCCTGTGTTTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981500445 Original CRISPR AAGCAGCCATCCGTGAGTCA AGG (reversed) Intergenic
No off target data available for this crispr