ID: 981504306

View in Genome Browser
Species Human (GRCh38)
Location 4:145482451-145482473
Sequence CACGCGAACGGGCCTCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981504306_981504314 8 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504314 4:145482482-145482504 ACCCATTGTGTCCCCCGCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 71
981504306_981504324 25 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504324 4:145482499-145482521 CGCCGGCGGGGCGACCCCTGCGG 0: 1
1: 0
2: 2
3: 10
4: 92
981504306_981504319 13 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504319 4:145482487-145482509 TTGTGTCCCCCGCGCCGGCGGGG 0: 1
1: 0
2: 0
3: 11
4: 65
981504306_981504317 11 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504317 4:145482485-145482507 CATTGTGTCCCCCGCGCCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 48
981504306_981504325 26 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504325 4:145482500-145482522 GCCGGCGGGGCGACCCCTGCGGG 0: 1
1: 0
2: 0
3: 7
4: 168
981504306_981504318 12 Left 981504306 4:145482451-145482473 CCGGGCCGAGGCCCGTTCGCGTG 0: 1
1: 0
2: 0
3: 1
4: 31
Right 981504318 4:145482486-145482508 ATTGTGTCCCCCGCGCCGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981504306 Original CRISPR CACGCGAACGGGCCTCGGCC CGG (reversed) Intronic
917845862 1:179019755-179019777 CACAAGAAAGGGTCTCGGCCAGG - Intergenic
1076636628 10:131885389-131885411 CAGGAGCGCGGGCCTCGGCCCGG + Intergenic
1108478441 13:50843449-50843471 CTCGCGCCCGGGCCCCGGCCGGG + Exonic
1118827679 14:69398738-69398760 CACTCGACCGGGCCTTGACCCGG - Exonic
1128782922 15:70374846-70374868 CACGCGAACGGCCCTGGGAAGGG - Intergenic
1130804315 15:87302637-87302659 CATGAGAATGGGCCTTGGCCTGG - Intergenic
1132641534 16:980678-980700 CCCGCGAGGTGGCCTCGGCCCGG - Intronic
1134149778 16:11796927-11796949 CGCGCGCACAGGCCCCGGCCCGG + Intronic
1140415988 16:74774408-74774430 CAAGTGAACGGGGCTCGCCCGGG + Intronic
1140500942 16:75433107-75433129 CACGCGCACACGCCTCGGGCCGG + Intronic
1142741990 17:1936779-1936801 CACCCGCACGGCCCCCGGCCCGG - Exonic
1142764003 17:2055897-2055919 CCCGCGTCCCGGCCTCGGCCTGG - Intronic
1148566620 17:48636718-48636740 CAGGCGCTCGGGGCTCGGCCTGG + Intergenic
1152732259 17:81978025-81978047 CTCGCGAGCTGGGCTCGGCCGGG - Intronic
1152894389 17:82902372-82902394 TACGCGAAGAGGCCTCGGGCTGG + Intronic
1153805266 18:8705184-8705206 CATGCGCACGGGCCTGGGCGAGG + Intergenic
1160098307 18:75896719-75896741 CACGAGAACTGGCCGCCGCCGGG + Intergenic
947860573 2:233354726-233354748 CAGGGCCACGGGCCTCGGCCGGG - Intronic
948637623 2:239349566-239349588 CAAGCGAGTGGGCCTCGCCCAGG + Intronic
1179994584 21:44968051-44968073 CAAGCCAGCGGGCCTGGGCCTGG + Intronic
1181934643 22:26429664-26429686 TACGAGCACTGGCCTCGGCCGGG - Intronic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950878247 3:16298359-16298381 CACGCGACCTGGCCTGGTCCTGG + Intronic
956681453 3:71785268-71785290 CACGCGCGCCCGCCTCGGCCCGG + Intergenic
966647191 3:182259748-182259770 CACGTGGAGGGCCCTCGGCCAGG + Intergenic
972886160 4:43491356-43491378 CACGCCATCCTGCCTCGGCCTGG - Intergenic
974394168 4:61313846-61313868 GACGGGAACGAGCCTTGGCCAGG + Intronic
981504306 4:145482451-145482473 CACGCGAACGGGCCTCGGCCCGG - Intronic
985525626 5:400041-400063 CACGCGAGCGGGCACCGGGCGGG - Intronic
1005882370 6:30071273-30071295 CACGCGAATGCGCCGCGGCGGGG + Exonic
1029338071 7:99919256-99919278 CAGGGGAACGGGCCGCCGCCCGG + Exonic
1040630973 8:49209884-49209906 CACCAGAAGGGGCCTGGGCCTGG + Intergenic
1058851123 9:109013132-109013154 CTCCGGGACGGGCCTCGGCCCGG - Intronic