ID: 981504900

View in Genome Browser
Species Human (GRCh38)
Location 4:145488945-145488967
Sequence TTGCATAGGCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981504896_981504900 -4 Left 981504896 4:145488926-145488948 CCTGGAAGGACATGTGAGTTTGC 0: 1
1: 0
2: 1
3: 15
4: 163
Right 981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG No data
981504895_981504900 5 Left 981504895 4:145488917-145488939 CCACTGTGGCCTGGAAGGACATG 0: 1
1: 0
2: 1
3: 29
4: 261
Right 981504900 4:145488945-145488967 TTGCATAGGCAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981504900 Original CRISPR TTGCATAGGCAGAAGGAAGA GGG Intronic
No off target data available for this crispr