ID: 981506646

View in Genome Browser
Species Human (GRCh38)
Location 4:145508205-145508227
Sequence GACTGAAGAATCTTATCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981506646_981506651 20 Left 981506646 4:145508205-145508227 CCATATGATAAGATTCTTCAGTC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 981506651 4:145508248-145508270 GCTTGTATCATCATCTCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981506646 Original CRISPR GACTGAAGAATCTTATCATA TGG (reversed) Intronic
901202316 1:7473644-7473666 TGCTGAAGAATCTTTTCAGAGGG + Intronic
902459192 1:16559650-16559672 TACTGAAGAATCTAATAATCTGG - Intergenic
904196234 1:28787750-28787772 GACTTGAGAATCCTATAATAAGG - Intergenic
908516706 1:64899821-64899843 GACACAAGAATCTTACAATATGG + Intronic
909337183 1:74488977-74488999 GACTTAAAACTCTTATCAGAGGG + Intronic
910533184 1:88264793-88264815 TACTGAAGAATCTACTCAAATGG + Intergenic
911490398 1:98558245-98558267 GACTGAAAAACATAATCATAGGG + Intergenic
912921997 1:113877563-113877585 GACTTAAACATCTTATCAGAAGG - Intergenic
916035357 1:160917395-160917417 GACTTTAGAATCATATCATTTGG - Intergenic
916352046 1:163861596-163861618 GACTGGAGAATCTTTTAATTGGG - Intergenic
918156945 1:181857258-181857280 GACTGAACATTCTTTTCTTATGG - Intergenic
920774860 1:208925930-208925952 GACTTAAAAATCATATAATAAGG + Intergenic
922304674 1:224333878-224333900 AACTGAAGACTGTTGTCATAGGG + Intergenic
922404815 1:225300973-225300995 TACTGAACAATCTGGTCATATGG + Intronic
1066126127 10:32345096-32345118 GACTGCAGAATCTTGTCTTTTGG - Intronic
1067959551 10:50833042-50833064 GACTGAAGAATAGAATCATCTGG + Intronic
1072547198 10:96448848-96448870 GTCTGGAGAATCTGCTCATATGG + Intronic
1074262129 10:111864522-111864544 GGCTGAATACTCTTATCAAAAGG + Intergenic
1075563041 10:123482187-123482209 GATTCAAGAATATTTTCATATGG - Intergenic
1077605453 11:3607683-3607705 AACTGCAGAGTCTTATCAGAAGG + Intergenic
1077647254 11:3936530-3936552 GACTAGAGAGTCTTATAATAAGG + Intronic
1078383469 11:10865540-10865562 AACTCAAGAATCTTTTCATAAGG - Intergenic
1080991388 11:37540348-37540370 CACTGAAAAATATTATCATATGG - Intergenic
1086972583 11:93099490-93099512 GTCTGAAGAATCTGGTCTTAAGG - Intergenic
1087349537 11:97014042-97014064 GACTGAAGCATTTAAACATAAGG + Intergenic
1087595484 11:100248792-100248814 GACTGAACAATCACACCATAAGG + Intronic
1087961285 11:104353330-104353352 GACTAAACAATCTTCACATATGG - Intergenic
1089818579 11:121200241-121200263 GCCAGCAGAAGCTTATCATAGGG + Intergenic
1091340550 11:134809418-134809440 GAGAGAAGAATATTGTCATATGG + Intergenic
1093191322 12:16078275-16078297 GACTGAATAATCTCAAGATATGG + Intergenic
1093196918 12:16140515-16140537 GGCTGAACAATTTTTTCATATGG + Intergenic
1093222658 12:16441854-16441876 GATTGCAGGATCATATCATAAGG + Intronic
1097569376 12:61313451-61313473 TACTGAACATTCTTATCATTCGG + Intergenic
1098210331 12:68157178-68157200 GATAGAACAATCTTTTCATAAGG + Intronic
1099473957 12:83085174-83085196 GGCTGAAGAATTTTAAAATAAGG + Intronic
1099816414 12:87654394-87654416 GACTGAAAAATCTTATGTTTTGG - Intergenic
1103606442 12:122089206-122089228 GCCTGAAGAACCTCTTCATATGG + Intronic
1104453050 12:128886826-128886848 GAGTGAAGATTTTTCTCATATGG - Intronic
1108666892 13:52641763-52641785 GAGTGCAGAATTTGATCATAAGG - Exonic
1109168783 13:59070117-59070139 TACAAAAGAACCTTATCATAAGG + Intergenic
1113090998 13:106617595-106617617 GACTGAAAAATCTAAGGATAAGG - Intergenic
1118632565 14:67719337-67719359 GAGTAAAGAATCTTATCGTGAGG - Intronic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125967282 15:43884580-43884602 GGCTGAAGAAACTTCTCAGAGGG - Intronic
1126669852 15:51105911-51105933 TTCTGAAGAAACTTATCCTAAGG + Intergenic
1129310494 15:74705003-74705025 GACTGAATAATTTCATTATATGG - Intergenic
1131994733 15:98123108-98123130 CACTGAAGAATCTTAAGAGATGG + Intergenic
1132150545 15:99455272-99455294 GGCTGGGGAATCTTATCAGAAGG + Intergenic
1133710016 16:8392238-8392260 GACTGTAAAATCTTCCCATAGGG - Intergenic
1140119210 16:72068841-72068863 GACTCCAGAATCTTAAAATATGG + Intronic
1147814837 17:43201739-43201761 GACTGAAGAAACTTCTGGTATGG - Exonic
1147888529 17:43700797-43700819 GACTGAAGAATATAATTATTAGG + Intergenic
1149384813 17:56131962-56131984 AACTTAAGAATCGAATCATATGG + Intronic
1150657592 17:67050366-67050388 GATTGAAGAATTTTATAAAATGG - Intronic
1151114510 17:71719658-71719680 GACTGAACAATCTAATCAAAAGG + Intergenic
1153133282 18:1882514-1882536 GACTGAATAAAATTATCTTAAGG + Intergenic
1164127693 19:22333553-22333575 GACTAAAGAATCTTTTCTTTAGG + Intergenic
1164819648 19:31237329-31237351 TAATGAGGAATATTATCATAAGG - Intergenic
1202675436 1_KI270711v1_random:1834-1856 TACTGAAGAATCTAATAATCTGG - Intergenic
1202708285 1_KI270714v1_random:234-256 TACTGAAGAATCTAATAATCTGG + Intergenic
925968218 2:9086086-9086108 GACTGCAGAATTTTCTAATATGG - Intergenic
927925307 2:27008739-27008761 GACTGAGGAAAGTTCTCATAGGG + Intronic
928108217 2:28486535-28486557 GCCTGAACAATCTTGTCAAAGGG - Intronic
930492767 2:52096723-52096745 GACTAAAAAATATTATGATATGG + Intergenic
930595573 2:53383896-53383918 CACTGAAGAGTTTTATAATATGG + Intergenic
939675608 2:145068577-145068599 GACTCAAGAATCTCATTATGAGG + Intergenic
940286659 2:152039116-152039138 TACTTAAGAATCTTATTATTGGG + Intronic
940938451 2:159527629-159527651 AACTGAACAATCTTTTCATCAGG + Intronic
941299672 2:163785663-163785685 GACAGAAGAAGTTTATTATAAGG - Intergenic
941822929 2:169860624-169860646 GACTTGAGCATCTTTTCATATGG + Intronic
943967565 2:194356575-194356597 GTTTGAAGAATTTTATGATAGGG - Intergenic
944819662 2:203417425-203417447 AACTGAAGTATCTGATTATAAGG - Intronic
946404260 2:219484193-219484215 GACTGAATGATCTGAGCATAGGG - Exonic
946869985 2:224076349-224076371 GACTGAGGAAGCTTACAATATGG - Intergenic
948833631 2:240613379-240613401 GAGTGAAGAATCTCATCAGATGG + Intronic
1168944560 20:1741765-1741787 GGCTGCAGAATCTTTTCACATGG - Intergenic
1169952229 20:11058011-11058033 GAATGAAGAATCAGATCAGAAGG - Intergenic
1171231382 20:23489525-23489547 AACTGAAGAATCTAGTCATAGGG + Intergenic
1177104054 21:16932572-16932594 GACAGAAGAAACTTTTCAAATGG + Intergenic
1178070254 21:28957403-28957425 GAGTGAAGATTCTTATCTTATGG - Exonic
1181786903 22:25233707-25233729 TCCTGAAGAATCATATTATAGGG - Intergenic
1184061603 22:42085841-42085863 CACTGAAGTGTCTAATCATAGGG + Exonic
955102898 3:55869497-55869519 GACAGAAGAATGGTTTCATATGG - Intronic
958574798 3:95935143-95935165 GCCTGAAGATTCTGATCAAAAGG - Intergenic
965413167 3:168357626-168357648 GACCAAAAAATTTTATCATAAGG + Intergenic
966435150 3:179875595-179875617 GATTGAAAAATCTTATCCAAGGG + Intronic
966707472 3:182932118-182932140 GACTGAATAATGTTATTGTATGG - Intergenic
966951810 3:184826763-184826785 GAGTGATGAAGCTTATTATAAGG - Intronic
971590292 4:28459095-28459117 GGCTGAAGAATATAATAATAGGG - Intergenic
973536050 4:51882988-51883010 GACTGAAGAATATTCTGATAAGG - Intronic
974254033 4:59426046-59426068 GATTGAAGAATTTTATTATATGG + Intergenic
974263606 4:59556678-59556700 GACTGATGAATTTTGTCAAAGGG + Intergenic
981506646 4:145508205-145508227 GACTGAAGAATCTTATCATATGG - Intronic
981826390 4:148946794-148946816 GACTGAAGAATATTTTGAAAAGG + Intergenic
982356784 4:154478580-154478602 GACACAAGAACCTTAGCATAGGG + Intronic
982481218 4:155913173-155913195 GTCTGAATAATCTTTTCAGAAGG + Intronic
987202498 5:15591444-15591466 GACTGGAGAATTTTACCATGGGG + Intronic
993443652 5:87985831-87985853 GACTGCATAAACTTATCAAAAGG - Intergenic
993970797 5:94417881-94417903 GACTGAAGAGTTTTATCAATTGG + Intronic
997824207 5:137091821-137091843 GACTGAAAACTCTTTGCATATGG + Intronic
1000925391 5:167187611-167187633 GACTGTAGAGTCACATCATAGGG - Intergenic
1001316770 5:170648245-170648267 GACTGATGAATCTTATGGTAAGG - Intronic
1001529075 5:172449697-172449719 GACTGAAAAGTCTGATGATACGG + Intronic
1006891432 6:37432772-37432794 GCCTGTAGCATCTTACCATATGG - Intergenic
1014229265 6:118884601-118884623 GACTGAATAATCCAATCAAAAGG + Intronic
1015654435 6:135500698-135500720 GAATGAAGAAACATATCAAAAGG + Intergenic
1020352939 7:7242810-7242832 GACTGAAAAATCATATCAGGTGG - Intronic
1022670486 7:32450780-32450802 ACCCGAAGAATCTGATCATAAGG + Intergenic
1023149498 7:37187994-37188016 GAATGAAGATTCTTGTCACAAGG - Intronic
1026227485 7:68455359-68455381 CACTGAAGATTTTTTTCATAAGG - Intergenic
1030933613 7:115556654-115556676 CACTGTAGAATATTAACATATGG - Intergenic
1031095142 7:117408243-117408265 GTCTAAAGACTCTTATCATTTGG + Intronic
1033179943 7:139166754-139166776 TACTGAAGGATCTTATCTTTTGG + Intronic
1033184325 7:139212753-139212775 GACTTAAGGATCTTATCAAGAGG + Intergenic
1034189486 7:149202749-149202771 AACTTAAGAATAATATCATAAGG - Intronic
1034531766 7:151700405-151700427 CACTGAAGAGTCTTGTCAAAGGG - Intronic
1038964950 8:32561904-32561926 GACTAAATAATCTTATAATGTGG - Intronic
1040444597 8:47480801-47480823 GAATGAAGAAACCTCTCATAGGG - Intronic
1043124151 8:76367323-76367345 TTTTGAACAATCTTATCATAGGG - Intergenic
1044118080 8:88359029-88359051 TACTGAAGCATTTTACCATATGG - Intergenic
1047291105 8:123531316-123531338 GACTGAATACTGTTATCACATGG + Intronic
1052128956 9:24816959-24816981 AAATGAAGAATCTCATTATATGG - Intergenic
1052244562 9:26318486-26318508 GACTGGAGGATCTTCTCTTAAGG + Intergenic
1052779692 9:32768282-32768304 GACTGAAGAGTTTTGGCATAAGG - Intergenic
1053785179 9:41648072-41648094 GACTGAAGAATCTCCTCACGTGG + Intergenic
1056246312 9:84698875-84698897 AAGTGAAGAATCAAATCATAGGG - Intronic
1057394245 9:94665517-94665539 GATTGAAAAATCATATCACAGGG + Intergenic
1058145295 9:101403932-101403954 GACAGAAGAATGTGAACATAAGG - Intronic
1061348821 9:130047694-130047716 CACTGAATAATCTGATCACATGG + Intergenic
1186925816 X:14332234-14332256 GAGTGAAGTCTCTGATCATAGGG - Intergenic
1187006636 X:15239257-15239279 CACAGACCAATCTTATCATATGG - Intronic
1187986125 X:24813451-24813473 GACTGAAGAATGTGATAATAAGG + Intronic
1189410108 X:40762525-40762547 GACTGAGGATTCTAATCACATGG - Intergenic
1193416202 X:81227841-81227863 AAATGAAGTATGTTATCATATGG - Intronic
1195837628 X:109135865-109135887 GACTGAAAAATCTAATGATAAGG + Intergenic
1198040343 X:132844774-132844796 CACTGAATAATCTAATCCTAAGG + Intronic
1200895711 Y:8374143-8374165 GGCAGGAGAATCTTATCATTAGG + Intergenic
1200969248 Y:9132780-9132802 AACTGAAGAAACTGATAATATGG - Intergenic
1202053228 Y:20802796-20802818 AACTGAAGAAGCTTGTCAGAAGG - Intergenic
1202141576 Y:21729710-21729732 AACTGAAGAAACTGATAATATGG + Intergenic
1202145289 Y:21774092-21774114 AACTGAAGAAACTGATAATATGG - Intergenic
1202251897 Y:22881598-22881620 GACAGAAGAGTCTCATCATCTGG + Intergenic
1202265118 Y:23010060-23010082 GACAGAAGAGTCTCATCATCTGG - Intergenic
1202404885 Y:24515347-24515369 GACAGAAGAGTCTCATCATCTGG + Intergenic
1202418109 Y:24643802-24643824 GACAGAAGAGTCTCATCATCTGG - Intergenic
1202452677 Y:25026284-25026306 GACAGAAGAGTCTCATCATCTGG + Intergenic
1202465894 Y:25154735-25154757 GACAGAAGAGTCTCATCATCTGG - Intergenic