ID: 981507414

View in Genome Browser
Species Human (GRCh38)
Location 4:145518072-145518094
Sequence GTTTCTCTTCAGAAGGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981507414_981507417 1 Left 981507414 4:145518072-145518094 CCCTGTACCTTCTGAAGAGAAAC 0: 1
1: 0
2: 2
3: 17
4: 181
Right 981507417 4:145518096-145518118 CTACTAAATCAAAGTGCAAGAGG No data
981507414_981507419 17 Left 981507414 4:145518072-145518094 CCCTGTACCTTCTGAAGAGAAAC 0: 1
1: 0
2: 2
3: 17
4: 181
Right 981507419 4:145518112-145518134 CAAGAGGCAGCCAGATGTGGTGG No data
981507414_981507418 14 Left 981507414 4:145518072-145518094 CCCTGTACCTTCTGAAGAGAAAC 0: 1
1: 0
2: 2
3: 17
4: 181
Right 981507418 4:145518109-145518131 GTGCAAGAGGCAGCCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981507414 Original CRISPR GTTTCTCTTCAGAAGGTACA GGG (reversed) Intronic
903004890 1:20291989-20292011 GTTGCTCTTCAGAAGGGAGGAGG - Intronic
904626337 1:31806725-31806747 GTTTGTTTTCAGTAGATACAGGG + Intronic
905271233 1:36789133-36789155 GTTTTTCTTCAGGAGGTAGAAGG - Intergenic
907105886 1:51882270-51882292 GTTTCTCTAAAGAAGGGAAATGG + Intergenic
912913865 1:113791620-113791642 CTTTCTATTCACAAGGCACAAGG - Intronic
913045059 1:115067331-115067353 GTTTTTCCTCTGAAAGTACAGGG + Intronic
913061652 1:115214130-115214152 GTTTGTCATCAGGAGTTACATGG + Intergenic
916517763 1:165535849-165535871 GTTTACCTTCAGAAAGAACAAGG + Intergenic
916704413 1:167333728-167333750 GTATCTCTTAAGAAGGGAAAGGG + Intronic
917315094 1:173715727-173715749 GTTTCTCTTCAAAAAGTGCTTGG - Intronic
918412342 1:184272864-184272886 TCTTCTCTTCAGAAGATACTGGG + Intergenic
918451121 1:184660598-184660620 GTTTCTCTTCAGCAGATTCTGGG - Intergenic
919087903 1:192943143-192943165 CTTCCTCTACAGAAGCTACAGGG + Intergenic
922212252 1:223495342-223495364 GTTTCTCTTTAGAAGCCAAATGG - Intergenic
1065238316 10:23678402-23678424 GTATTTCTTCAGTAGATACAGGG - Intergenic
1065337418 10:24667667-24667689 GTTTTTCTTTCTAAGGTACATGG - Intronic
1065709168 10:28498889-28498911 GTTTCCCTTCAGAAGAACCATGG - Intergenic
1067743806 10:48917548-48917570 GTTTCTCATCAGAAACCACAGGG + Intronic
1067805485 10:49389541-49389563 ATTTCTGTTTAGAAGCTACACGG - Intronic
1070043139 10:72802159-72802181 GTACCTCTTCAGGAGGCACATGG + Intronic
1070617349 10:77979163-77979185 TTCTCTTTTCAGAAGGGACAGGG - Intronic
1073377504 10:103049144-103049166 GCTTCTCTTAAGAATGTACTTGG - Intronic
1074572977 10:114641677-114641699 GTTTTTCCTCAGAATCTACACGG - Intronic
1077185383 11:1233405-1233427 TTTTCTCTTCAGAATGTGCTGGG - Intronic
1077670839 11:4156015-4156037 GTTTCTCTAAAGAAGCTAAATGG - Intergenic
1078324056 11:10364944-10364966 CTTTCACTTCAGAAATTACAAGG - Intronic
1079939577 11:26662135-26662157 CTTTCTCTCCAGAAGAAACATGG + Exonic
1080006099 11:27408693-27408715 GTTTCTGTTCACAATGTAAAAGG - Intronic
1080169391 11:29281394-29281416 GATTCTCTCCAGAGGGTGCAGGG + Intergenic
1082649623 11:55773225-55773247 GCTTCTGTTCAGAAGGTTGATGG + Intergenic
1084455049 11:69263641-69263663 GTTGCTCTTCTGGAGTTACAAGG + Intergenic
1085331225 11:75653039-75653061 GATTCTGTTTAGAGGGTACAGGG - Intronic
1087728650 11:101753254-101753276 GTTGCTCCTCAGGAGGTACTAGG - Intronic
1089002168 11:115060908-115060930 GTTTCTCTTCAGAAAGTAGAAGG + Intergenic
1091726952 12:2853040-2853062 GTTTCTACTCAGAAGGTCCTGGG + Intronic
1095485761 12:42683044-42683066 CTTCCTCTTCAAAAGTTACATGG - Intergenic
1096683536 12:53272843-53272865 GTGCCTCCTGAGAAGGTACAAGG + Exonic
1100905960 12:99299358-99299380 CCTGCTCTTCAGAAGCTACAAGG - Intronic
1105764379 13:23544936-23544958 GTGTAGCTTCAGAAGGCACAAGG - Intergenic
1106489696 13:30208659-30208681 GTTCCTCTTTAGAAAGTGCACGG + Exonic
1107093908 13:36514623-36514645 CTTTCTTTTCACAAGCTACATGG + Intergenic
1110248764 13:73357596-73357618 GTTTCTCTTAAAAATGTACAAGG + Intergenic
1110552626 13:76826038-76826060 GTTTCTCTTAAGAAGAAAAAAGG + Intergenic
1110672717 13:78200408-78200430 TTGTCTCATCAGAAAGTACATGG - Intergenic
1111781234 13:92727700-92727722 GTTTCTTTTCAGAAGTGAGAGGG - Intronic
1112773394 13:102817405-102817427 GTTTCACATCAGAAGGCACATGG + Intronic
1118172915 14:63406797-63406819 GGTTCTCTTAAGATGTTACATGG - Intronic
1121801308 14:96776388-96776410 GTGTCCCTTGAGAAGGAACATGG - Intergenic
1121915205 14:97832220-97832242 GTTTCAATTCAGATGGTCCAGGG - Intergenic
1122878865 14:104681003-104681025 GTTTCTGTTTAGGAGGCACATGG - Intergenic
1123175970 14:106419423-106419445 TTTTCAGTTCAGAAGGCACAGGG + Intergenic
1126350842 15:47743387-47743409 TTTTTTCTTGAGAAGGCACAGGG + Intronic
1126749301 15:51860501-51860523 GCTTGTCTTCAGAAAGTGCAAGG - Intronic
1127688740 15:61374026-61374048 ATTTCTCTCCAGAAAGAACAAGG - Intergenic
1129021183 15:72520202-72520224 GCTTCTCTACAGAAACTACAAGG - Intronic
1130619110 15:85442829-85442851 ATTTCTCTTGAGAAGGGAAAAGG + Intronic
1130842649 15:87715970-87715992 GTTTCAATTCAGAAGATACCTGG - Intergenic
1131085787 15:89574942-89574964 GTTTATCTGCAGAAGGTAATCGG - Intergenic
1132086277 15:98910914-98910936 GTCTCTCTTAAGAAGTTTCAGGG + Intronic
1132094017 15:98968829-98968851 GTTTCACCTCAGAAAGAACATGG + Intronic
1133668338 16:7993225-7993247 GTTTTTCTTCAGAAGGAATATGG - Intergenic
1135854520 16:25994936-25994958 GGTTTTATTCAGTAGGTACATGG - Intronic
1137886806 16:52113391-52113413 GTTTCTTTCCAGAAGTTACTGGG - Intergenic
1138277586 16:55747238-55747260 GTTTCTGTGCAGAGGGTACATGG - Intergenic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1143524766 17:7465821-7465843 GTGTCTCTTCAGACTGGACAGGG + Exonic
1144731477 17:17528736-17528758 GTTTCTGTTCAGAAGGCCAATGG - Intronic
1149161790 17:53702566-53702588 ATTTTTCTTCAGAAGTAACAGGG + Intergenic
1150605769 17:66689460-66689482 TTTTTTCTACAGAAAGTACAAGG + Intronic
1150759277 17:67945629-67945651 GTTGTGCTTCAGAAGGGACATGG - Exonic
1154351923 18:13590482-13590504 GTGACTGTTCAGAATGTACACGG + Intronic
1156314169 18:35951830-35951852 GTTACACTTCTGGAGGTACAGGG + Intergenic
1158569357 18:58583848-58583870 GTTTCTCTGCAGAGGGCTCATGG - Intronic
1158618119 18:59006212-59006234 CTCTCTCTTCTAAAGGTACATGG - Intergenic
1160833434 19:1113679-1113701 GTCTCTCTGCAGGAGGCACAGGG + Exonic
1161124770 19:2549664-2549686 GTGTCTCTCCAGAAGGTTCTGGG - Intronic
1163326581 19:16607417-16607439 GTTCCTCTTCAGAAGGCACGAGG - Intronic
1165223823 19:34339890-34339912 GCTTCTCTGCAGCAGGGACATGG - Exonic
1168075195 19:53977533-53977555 ATTTCTCTCCAGAAGGTTCCAGG + Intronic
1168453379 19:56483961-56483983 GTTGCCCTTCAGCAGGAACATGG - Intergenic
1168678108 19:58293747-58293769 GTTTCTCTTCGGGAGGTTCTGGG - Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925354066 2:3224824-3224846 GTTCCTCTTCAGATGTAACAGGG - Intronic
927627754 2:24741429-24741451 GTTTCTCTTAACAATGTTCATGG + Intronic
928407521 2:31025954-31025976 GTTACTCTTCATAATGTAGACGG - Intronic
929696686 2:44122969-44122991 GTTTCACTTAAGAATGTACTTGG - Intergenic
931572982 2:63689334-63689356 GTTTCTTTTCTGAAGTTAGAGGG - Intronic
931761734 2:65423641-65423663 CTTTCTTTTCAGAATTTACAAGG - Intronic
932235832 2:70120427-70120449 GATTCTCTGCAGATGGTTCATGG + Intergenic
934927332 2:98390809-98390831 GTTGGTCTTCTGAGGGTACACGG + Intronic
935156138 2:100485225-100485247 GATTCTCTTAAGAAGCCACAAGG + Intergenic
936384733 2:112019136-112019158 GTTTCTTTTTAGAAGGTATGAGG - Intronic
936596493 2:113853243-113853265 GTTTCTGTTCAGTAGGTCTAGGG - Intergenic
937635449 2:124150890-124150912 GCTACTCTTCAGAAGGGACAGGG - Intronic
939050973 2:137307498-137307520 GTGTGTCTTCAGAAGGTAAATGG - Intronic
939322596 2:140643373-140643395 CTGCCTCTTCAGAAGGTACTAGG + Intronic
939634237 2:144561431-144561453 ATTTCTATTCAGAAGCTACTGGG + Intergenic
941730567 2:168912862-168912884 GATTCTCTTCAGAAATCACATGG - Intronic
942140938 2:172977133-172977155 GTTACTCTTATGAAGGTGCATGG + Intronic
944731462 2:202521795-202521817 GTTTCTCATCACAAAGTACAGGG - Intronic
945753649 2:213819427-213819449 CTTCCTTTTCAGAAGGTAGATGG + Intronic
948256245 2:236570122-236570144 CTTTCTCTTCAGAAAGCAAAGGG + Intronic
1169262185 20:4147356-4147378 GTTTATCTTTAGAAGGTGAACGG - Intronic
1169523318 20:6396720-6396742 GTCTTTCTTAAGAAGGTATATGG + Intergenic
1174145970 20:48452825-48452847 GCTTCTTTTCAGAAGGAGCAGGG - Intergenic
1177582232 21:23039668-23039690 TTGTGTCTTCACAAGGTACAGGG - Intergenic
1177999240 21:28140506-28140528 ATTTCTCTTCAGAAGATCTAGGG - Intergenic
1185161227 22:49230939-49230961 GTATTTTTTAAGAAGGTACAAGG - Intergenic
950657077 3:14443352-14443374 GCTTCTCTTCAGCAGGTGCCCGG + Intronic
951688906 3:25374777-25374799 TCTTCTTTTCAGAATGTACAAGG + Intronic
953544485 3:43854255-43854277 GGTTCTCCTCAGATGGTACCGGG + Intergenic
955702985 3:61700730-61700752 TTTTCTCTTCTGAATGTAGAAGG + Intronic
956230306 3:67007662-67007684 GTTTGTATTGGGAAGGTACAAGG - Intronic
956899792 3:73703560-73703582 GTGTTTCTTCAGAAGGTTCTAGG + Intergenic
957892646 3:86379730-86379752 GTCTGTCTTCAGAATGTACATGG + Intergenic
957933376 3:86911434-86911456 GTTTCTTATCAGGAGGTACCGGG - Intergenic
958498752 3:94878391-94878413 GTTTATGTTCAGAGGATACAAGG + Intergenic
959410483 3:106015181-106015203 TTTTCTGATCAGAAGGTACTGGG - Intergenic
963278240 3:143354378-143354400 GGTTCACTTCACAAGGTAGATGG - Intronic
965075728 3:163973360-163973382 ATTTCTGTTCAGAAGTTTCACGG - Intergenic
965094680 3:164209768-164209790 GTTTGTGTTCAGAAGATTCATGG - Intergenic
966416023 3:179690229-179690251 TTTTCTTTTCAGAAGGTAAGAGG + Exonic
967242687 3:187456544-187456566 GTGTCCCTGCTGAAGGTACAGGG + Intergenic
967704657 3:192635787-192635809 GTTTCTCTTCTGAAGTTCTATGG + Intronic
968116232 3:196092153-196092175 ATTTCTATTCAAGAGGTACAGGG + Intergenic
969034582 4:4242900-4242922 GTTTCTCTTAGAAAGGTGCAAGG - Intronic
969274719 4:6127602-6127624 GTTTCTCTTCACACGGTGCGGGG - Intronic
976993341 4:91397961-91397983 ATTTCTCTGCAAAATGTACAAGG - Intronic
978173389 4:105701533-105701555 TTTTTTCCTCAGAACGTACATGG - Intronic
979033529 4:115682200-115682222 GTTTGTATTAAGAAGGCACAAGG - Intergenic
979406457 4:120317058-120317080 GTTTGTATTCAGAAGGTACAGGG + Intergenic
979746376 4:124218596-124218618 TTTACTCTGCAGAAGGTAGAGGG + Intergenic
981404912 4:144356699-144356721 ATTTCTTTTCAGAATCTACAGGG + Intergenic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
981593254 4:146389000-146389022 GTTACTATTCAGAATCTACAAGG + Intronic
983839603 4:172440237-172440259 GATGCTCTTCAGTAGGTAAATGG + Intronic
984320365 4:178188069-178188091 GTTTCTCAACAAAAGGTAAAAGG + Intergenic
984954185 4:185029625-185029647 GTTTCTCTTCTGTAGCTCCAGGG - Intergenic
987762680 5:22185977-22185999 ATTTCTCTTCAGAATGTTCTGGG - Intronic
988340952 5:29970981-29971003 GTTTCCCTTGAGAAAATACAGGG + Intergenic
989098824 5:37806046-37806068 GTTTCTCTGCAGAATGTTCTCGG - Intergenic
990848475 5:60173096-60173118 GTTTCTCTCCAGTAGGCACATGG + Intronic
991897470 5:71419366-71419388 ATTTCTCTTCAGAATGTTCTGGG - Intergenic
992600833 5:78397807-78397829 GTTTCTCCTTAGAAGATAAATGG + Intronic
993318436 5:86441027-86441049 ATTTCTCTTCAGGAGGGACCCGG + Intergenic
993440710 5:87953710-87953732 GTCTCTATTGAGAAAGTACAAGG - Intergenic
995152366 5:108863988-108864010 GTTTCTCTTCAGCAGTGACAGGG + Intronic
995705850 5:114989045-114989067 CTCTCTCTTCAGAAGGCATAAGG + Intergenic
996970451 5:129360721-129360743 TTTTCTGTTTAGTAGGTACACGG + Intergenic
997645684 5:135480302-135480324 GTTTCTCTTGAGATGTTTCATGG + Intergenic
997781502 5:136663881-136663903 GTTTCTGCTCTGAAGGAACAAGG - Intergenic
1000431163 5:161154222-161154244 GTTTCTCATCACAAATTACAAGG + Intergenic
1000707740 5:164532631-164532653 GTTTCTTTTCAGCCTGTACAGGG + Intergenic
1001665256 5:173428019-173428041 GTTTCTCTTCAGAAATCACTGGG + Intergenic
1001706921 5:173748240-173748262 AGTTCACTTCAGAAGGTAGATGG - Intergenic
1001880131 5:175236159-175236181 ATTTCTATGCACAAGGTACAAGG + Intergenic
1004855679 6:19747009-19747031 TTTTCTCTTCTGAAAGTAAATGG + Intergenic
1005132913 6:22532314-22532336 CTTTAACTTCAGAAGGAACATGG + Intergenic
1005405905 6:25487696-25487718 ATTTCTTTTCAGAAGGGAAAAGG - Intronic
1010353409 6:74903074-74903096 GTTTCTCTTCTGTAGGAACTTGG + Intergenic
1011919158 6:92548808-92548830 GTTTTTTTTCATAAGGTACAAGG - Intergenic
1012227854 6:96725155-96725177 TTTTCTCTTCAGAAGGAAAGAGG - Intergenic
1013195153 6:107838248-107838270 GTTTCTCTTCACAGGTAACAGGG + Intergenic
1020409776 7:7878334-7878356 GTTTTTCTTCAGGAGGCAGAGGG - Exonic
1020786227 7:12576380-12576402 GTTTCCCCTCAGAAGATACTTGG + Intronic
1020836630 7:13161254-13161276 CTTTGTATTCAGAAGGTACCAGG + Intergenic
1021074571 7:16286427-16286449 GTTTCTCTGTAGAACTTACACGG + Intronic
1022405258 7:30083817-30083839 GTTTCTGTTTGTAAGGTACAGGG - Exonic
1023231107 7:38029985-38030007 GTTTGTCTTCAGAAGTTTCTTGG - Intergenic
1025798750 7:64764072-64764094 GGCTCCCTTCAGCAGGTACATGG + Intergenic
1030697840 7:112605039-112605061 GTTTCTCTTTGGATGGTTCAGGG - Intergenic
1032360963 7:131254192-131254214 GTTGCTCCTCAAAAGGTACAGGG - Intronic
1033030701 7:137823440-137823462 GCTTCTTTGCAGAGGGTACATGG - Intronic
1036196815 8:6724968-6724990 GTTTTTCTACAGATGGCACATGG + Intronic
1037814645 8:22105577-22105599 ATTTGTCCTCAGAGGGTACAAGG + Intergenic
1039709442 8:40041285-40041307 ATTTCTCTTGAGAAGGAAAAGGG - Intergenic
1041191521 8:55360285-55360307 GTTTCTCTTCAAAATGCAAAAGG - Intronic
1041202086 8:55459920-55459942 ATTTCTCTTGAGAAGTTACCTGG - Intronic
1041458311 8:58084086-58084108 GTGTATCTTCAGAAGTTACAAGG + Intronic
1043792896 8:84495813-84495835 GTGTCTCTTCAGATGTAACAAGG + Intronic
1043918608 8:85954067-85954089 GTTTCTCTTCATCAGCAACAAGG - Intergenic
1046461724 8:114547335-114547357 GTTTCGCTTCAGCTGGTACTGGG - Intergenic
1049774451 8:144398008-144398030 GTCACTCTTCAGCAGGAACATGG + Exonic
1049871435 8:144980944-144980966 GTTGCTATTCAGTGGGTACAGGG + Intergenic
1050340611 9:4634232-4634254 ATTGCTCTTCAGAAGATAAAAGG - Intronic
1051925709 9:22322467-22322489 TCTTCTCTTCTGAAGCTACAGGG + Intergenic
1052094979 9:24373064-24373086 GTTTCTATTCATAAAGTAGAAGG + Intergenic
1052245038 9:26324154-26324176 ATTTCTCTGAAGAAGGGACATGG - Intergenic
1059155914 9:111988171-111988193 CCTTCTCTTCAGAAGCTAGAAGG - Intergenic
1059328790 9:113521890-113521912 GTTCTTCTTCAGAAGAGACAAGG + Intronic
1059477720 9:114561270-114561292 GTTTGTCTTTGGAAGGTGCAGGG + Intergenic
1062001370 9:134217380-134217402 TTTTCTTTTCAGATGGTACAGGG - Intergenic
1186209596 X:7235448-7235470 GTTTTTCTGAAGAAGGTTCAAGG - Intronic
1188445460 X:30249459-30249481 ATTCCTCTTCAGAAGTAACAGGG + Intronic
1188970003 X:36603511-36603533 GTTTCTGTTCTGTAGATACATGG - Intergenic
1189129587 X:38484757-38484779 GTATCTCTTCAGAAGGCTCAAGG - Intronic
1195294963 X:103467078-103467100 GTTTCTCTTGAGTATGTACCTGG + Intergenic
1197166356 X:123381945-123381967 GTGTTTCTTCAGAAGGTTTAGGG + Intronic
1197697076 X:129561753-129561775 GTTTGTCTTTAGAAGGTATGTGG + Intronic
1200448464 Y:3294292-3294314 ATTTTTTTCCAGAAGGTACAAGG + Intergenic