ID: 981509569

View in Genome Browser
Species Human (GRCh38)
Location 4:145541093-145541115
Sequence AGGAAGGGAGAGAGGTAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8848
Summary {0: 1, 1: 0, 2: 51, 3: 913, 4: 7883}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509569_981509580 13 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509580 4:145541129-145541151 CTGTATGATGGGCAGGTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 148
981509569_981509578 6 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509569_981509575 1 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509575 4:145541117-145541139 CTCACCACTAACCTGTATGATGG No data
981509569_981509576 2 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509576 4:145541118-145541140 TCACCACTAACCTGTATGATGGG 0: 1
1: 0
2: 0
3: 7
4: 109
981509569_981509581 18 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509581 4:145541134-145541156 TGATGGGCAGGTTAGTGGTGAGG 0: 1
1: 0
2: 0
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509569 Original CRISPR AGGAAGGGAGAGAGGTAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr