ID: 981509570

View in Genome Browser
Species Human (GRCh38)
Location 4:145541101-145541123
Sequence TGGTGAGGAGGAAGGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3033
Summary {0: 1, 1: 4, 2: 24, 3: 338, 4: 2666}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509570_981509580 5 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509580 4:145541129-145541151 CTGTATGATGGGCAGGTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 148
981509570_981509578 -2 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509570_981509576 -6 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509576 4:145541118-145541140 TCACCACTAACCTGTATGATGGG 0: 1
1: 0
2: 0
3: 7
4: 109
981509570_981509575 -7 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509575 4:145541117-145541139 CTCACCACTAACCTGTATGATGG No data
981509570_981509581 10 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509581 4:145541134-145541156 TGATGGGCAGGTTAGTGGTGAGG 0: 1
1: 0
2: 0
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509570 Original CRISPR TGGTGAGGAGGAAGGGAGAG AGG (reversed) Intronic
Too many off-targets to display for this crispr