ID: 981509571

View in Genome Browser
Species Human (GRCh38)
Location 4:145541108-145541130
Sequence AGGTTAGTGGTGAGGAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 0, 3: 53, 4: 504}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509571_981509578 -9 Left 981509571 4:145541108-145541130 CCCTTCCTCCTCACCACTAACCT 0: 1
1: 0
2: 0
3: 53
4: 504
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509571_981509581 3 Left 981509571 4:145541108-145541130 CCCTTCCTCCTCACCACTAACCT 0: 1
1: 0
2: 0
3: 53
4: 504
Right 981509581 4:145541134-145541156 TGATGGGCAGGTTAGTGGTGAGG 0: 1
1: 0
2: 0
3: 27
4: 271
981509571_981509580 -2 Left 981509571 4:145541108-145541130 CCCTTCCTCCTCACCACTAACCT 0: 1
1: 0
2: 0
3: 53
4: 504
Right 981509580 4:145541129-145541151 CTGTATGATGGGCAGGTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509571 Original CRISPR AGGTTAGTGGTGAGGAGGAA GGG (reversed) Intronic
900741713 1:4334193-4334215 AGGCTAGTTGGGAGGAGGGAGGG + Intergenic
901236932 1:7672197-7672219 AGACTGGGGGTGAGGAGGAAAGG + Intronic
901298841 1:8183548-8183570 AGGGTAGTTGTAAGGATGAAAGG + Intergenic
901790393 1:11650764-11650786 AGGCGAGTGCTGAGGAGGAGCGG - Exonic
902248929 1:15140595-15140617 AAGTGAGTGGTGAAGAGGATAGG + Intergenic
903510662 1:23872541-23872563 AGGTTAGTGGTTAAGAGGGCAGG + Exonic
904385672 1:30140572-30140594 AGGATGGTGGTGGGGAGGATGGG - Intergenic
904474877 1:30758274-30758296 AGGATTGAGGTGAGGATGAAAGG - Intergenic
904586071 1:31581349-31581371 AGGTGAGAGGTGATGAGGGACGG + Intronic
904598870 1:31663021-31663043 AGGTAGGTGGGGAGGAGGCAGGG - Intronic
904599274 1:31664871-31664893 AGGTAGGTGGGGAGGAGGCAGGG - Intronic
904747723 1:32721126-32721148 GGCTTAGTGATGAGGAGGGAAGG - Intergenic
905206971 1:36348468-36348490 AGGTTAGTGCTAGGGAGGAACGG - Intronic
905350241 1:37340801-37340823 AGGTTTGTGATGAGGATTAAAGG - Intergenic
905672741 1:39802970-39802992 AGGTTGGTGCTGAGGACAAAGGG - Intergenic
905875789 1:41431350-41431372 AGGTGAGGAGTGAGGGGGAAGGG + Intergenic
906065224 1:42975652-42975674 AGGGCTGTGGTGAGGATGAAGGG + Intergenic
906115330 1:43352733-43352755 AGCTTAGTGGTAGGTAGGAATGG - Exonic
907453977 1:54563448-54563470 AGGGTTTTGGTGAGGATGAATGG + Intronic
907579756 1:55561084-55561106 AGGTGAGTGTTGAGAAAGAAAGG - Intergenic
907956496 1:59233003-59233025 AAGTTAGAGATGAGGAGGAAGGG + Intergenic
908147504 1:61262901-61262923 AGGTTAGTGTTGGGGATGGATGG - Intronic
908164872 1:61448163-61448185 AGGTTGGGGGTGAGGAGAAAAGG - Intronic
909418213 1:75431597-75431619 AGTCTAGTGGCGAGGAGGAGTGG + Intronic
910838764 1:91541597-91541619 AGCTGAGTGGTGAGAAAGAATGG - Intergenic
910875655 1:91875525-91875547 AGGGGAGAGGAGAGGAGGAAAGG + Intronic
911040831 1:93589433-93589455 AGGTGAGTGAGGAGTAGGAAAGG + Intronic
911101928 1:94102123-94102145 AGGATTGTTGTGAGGAGTAAGGG + Intronic
911162824 1:94698667-94698689 AGGGTATTGGTGAGGAAGAACGG - Intergenic
912336651 1:108868963-108868985 ATGTTAGTGGTTGGGTGGAATGG - Intronic
912338870 1:108890189-108890211 AAGGGAGAGGTGAGGAGGAAGGG - Intronic
912688629 1:111786786-111786808 AGGAGACTGGTGAGCAGGAAGGG + Intronic
912747327 1:112255832-112255854 GGACTAGAGGTGAGGAGGAATGG + Intergenic
913288800 1:117252937-117252959 AGTTTTGAGGGGAGGAGGAAAGG - Intergenic
913376415 1:118157502-118157524 AGGGAAATGGTCAGGAGGAAAGG - Intronic
914252833 1:145935822-145935844 AAGGTAGTGGTGGGGAGGAAAGG + Exonic
914884129 1:151571211-151571233 GGCTTGGCGGTGAGGAGGAAGGG + Intronic
914901419 1:151713222-151713244 AGGGTGGGGGTGAGGAAGAAGGG - Intronic
915004978 1:152627426-152627448 TGGTTAGTGGTGCAAAGGAAGGG - Intergenic
915032699 1:152897078-152897100 GGGCTATTAGTGAGGAGGAAAGG + Intergenic
915681293 1:157584272-157584294 AGATTAGGGGAGAGGAAGAAGGG - Intronic
916047751 1:161013478-161013500 GGGTGAGTGGTGGGGAGGAAGGG - Intronic
917218097 1:172698916-172698938 AGGTTAAAGGAAAGGAGGAAAGG - Intergenic
917328156 1:173854635-173854657 AGGGTAGTGGTTAGGAGCATGGG - Intronic
917600571 1:176569927-176569949 AGATTTGTGGGGATGAGGAAGGG - Intronic
918140133 1:181713117-181713139 AGGCATGGGGTGAGGAGGAAGGG + Intronic
918380997 1:183955105-183955127 AGGATAATGGTTAAGAGGAAGGG + Intronic
918843537 1:189577933-189577955 AGGTAAGGGGTGATGGGGAACGG - Intergenic
919148911 1:193669909-193669931 AGGGTAGTGGGGAGGTGGGATGG - Intergenic
919815177 1:201432815-201432837 AGGGGAGGGGAGAGGAGGAAAGG + Intergenic
920067155 1:203277107-203277129 AGGATAGTGATGAGCAGGGATGG - Intergenic
921904226 1:220479343-220479365 AGGGTAGTGGAGAGGGGAAATGG - Intergenic
922209907 1:223478998-223479020 AGGTTGGGGGTGAGGAGGTTGGG + Intergenic
922209913 1:223479013-223479035 AGGTTGGGGGTGAGGAGGTTGGG + Intergenic
922209943 1:223479092-223479114 AGGTTGGGGGTGAGGAGGTTGGG + Intergenic
922887307 1:229030047-229030069 AGGTGCCTGGGGAGGAGGAAGGG - Intergenic
923241382 1:232088764-232088786 AGAGTAGTGGTGAAGAGGACAGG + Intergenic
923727543 1:236520458-236520480 AGGTTTGCTGTGAGGAGGAATGG - Intronic
924332613 1:242955058-242955080 GGGTTAGGGGAAAGGAGGAAAGG - Intergenic
924819276 1:247472811-247472833 AGGTTGGTGAGGAGGAGGCATGG - Intergenic
1062960223 10:1567728-1567750 AAGATAGTGGTGAGGAAGAGAGG - Intronic
1063847311 10:10145102-10145124 AGCTCAGTGGTGGGCAGGAATGG - Intergenic
1064462496 10:15548728-15548750 AGTTTAATGGCGAGGATGAATGG + Intronic
1064899089 10:20274079-20274101 AGGGGAGGGGAGAGGAGGAAAGG + Intronic
1065830626 10:29610739-29610761 AGGTTGGTGGGCAGGAGGAAAGG - Intronic
1069146468 10:64897435-64897457 AGGATGGTGGAGAGGAGGCAGGG - Intergenic
1069723334 10:70562930-70562952 AGATTTGTGCTCAGGAGGAAGGG - Intronic
1071154363 10:82672321-82672343 AGGAGACTGGAGAGGAGGAAGGG + Intronic
1071384695 10:85107352-85107374 AGGGTGGTGGTGGGGAAGAATGG + Intergenic
1071998071 10:91165919-91165941 AAGTTAGTGCTGAAGAAGAATGG + Intronic
1072220537 10:93324026-93324048 AGGTAAGTGGCTAGCAGGAAGGG + Intronic
1073192388 10:101660992-101661014 AGGTGGGTATTGAGGAGGAAGGG + Intronic
1074572173 10:114634008-114634030 AAGGAAGGGGTGAGGAGGAATGG - Intronic
1074772677 10:116743482-116743504 ATGTTAGTTATGGGGAGGAAAGG - Intergenic
1074857458 10:117483824-117483846 AGGTTGGTGGGGAGGCGGTAGGG + Intergenic
1075452694 10:122563156-122563178 AGGTTTGTGCTGGGCAGGAAAGG + Intronic
1075580153 10:123611508-123611530 AAGGTAGGGGTGAGGAGGAAAGG + Intergenic
1075735380 10:124661603-124661625 AGGGCAGTGGGGAGGAGGGAAGG + Intronic
1076786558 10:132752567-132752589 AGGGGAGTGGTGAGGAGGTGTGG + Intronic
1077410314 11:2400801-2400823 AGGTTTGTGGTGAGGGAGGACGG + Intronic
1077701832 11:4449561-4449583 TGGGCAGTGCTGAGGAGGAAAGG - Exonic
1078318320 11:10309850-10309872 AGGGGAGTGATGGGGAGGAATGG + Intronic
1078660394 11:13281120-13281142 CGGGTAGAGGTGAGAAGGAATGG - Intronic
1079909879 11:26296576-26296598 AGGTTAGGGGTTAGGAAAAAAGG + Intergenic
1080255854 11:30289592-30289614 AGGTCTGAGGTGGGGAGGAAAGG - Intergenic
1080798051 11:35583811-35583833 AGAATAGTGGTAAGGAGGAGAGG + Intergenic
1081732446 11:45381011-45381033 GGCTGAGTGGTGAGGAAGAATGG - Intergenic
1082818028 11:57523378-57523400 AGGATAGTGGTGAGGAAGGTGGG - Intergenic
1083174118 11:60938742-60938764 AGGTGAGTGGGTAGGAGGAGCGG - Intronic
1083538779 11:63496211-63496233 AGGGTAGTGGGGAGGTGGGAGGG - Intergenic
1083641041 11:64145489-64145511 AGGGCAGGGGTGAGGAGGACAGG - Intronic
1085243396 11:75077144-75077166 AGATTGGTGGAGAGGAGGTATGG - Intergenic
1085503539 11:77042482-77042504 AGGTGAGTGCCCAGGAGGAAGGG - Intergenic
1085551062 11:77372675-77372697 AGGTGGGTGATGAGGAGGATTGG - Intronic
1085691841 11:78670581-78670603 AGGAGGGTGGTGAGGAGAAAGGG + Intronic
1085697163 11:78714790-78714812 AGGTGAAGGGTGAGTAGGAAAGG - Intronic
1086153728 11:83642359-83642381 AGAGAAGGGGTGAGGAGGAATGG - Intronic
1086415599 11:86586267-86586289 AGGTTAGTGGGTAGGAGCAATGG + Intronic
1087861487 11:103163342-103163364 AGGCCAGTGGTGAGTAGGATGGG + Intronic
1088034840 11:105298748-105298770 AGTTTGGTGGAGAGGATGAATGG + Intergenic
1088097237 11:106115426-106115448 AGGCTAGTGGGGAGAAGGCAGGG - Intergenic
1088578802 11:111297754-111297776 AGCTCTGTGGGGAGGAGGAAAGG + Intergenic
1089150671 11:116361411-116361433 AGTTTAGTGGGCAGGAGGAGTGG + Intergenic
1089583309 11:119495044-119495066 AGGTGAGAGGTGAGGAAGAGAGG + Intergenic
1089624915 11:119745238-119745260 AGGTTGGTGGTGAGAAGGGCGGG + Intergenic
1090227141 11:125078533-125078555 ATGTGAGGGGTGGGGAGGAAAGG + Intronic
1091037275 11:132245393-132245415 AGGACAGAGGTGAGGAGGGAGGG + Intronic
1091158295 11:133394545-133394567 AGGGTAGTGGGGAGATGGAAGGG - Intronic
1091253399 11:134163072-134163094 AGGTTAGAGGTGAGGATGGAGGG + Intronic
1091680223 12:2521733-2521755 AGGTGAGGGGAGAGGAGGGAAGG - Intronic
1091816818 12:3444974-3444996 AGGTTAGGGGTGATGGGGAAGGG + Intronic
1091840098 12:3614642-3614664 AGGTGGGGGGTGAGAAGGAAAGG + Intronic
1095108256 12:38261152-38261174 AGGGTGGTGGTGGGAAGGAAGGG - Intergenic
1095361098 12:41340441-41340463 AGGTTGGGGGTGAGGAAGTAGGG + Intronic
1096100520 12:48968189-48968211 AGGGCAGTGGTGAGCAGGATCGG - Exonic
1096201063 12:49683452-49683474 AGGATAGAGGTGAGGGAGAAGGG - Intronic
1096869692 12:54585545-54585567 AGGTTAGCAGTGGGGAGGGAAGG + Intronic
1097258696 12:57700279-57700301 ATGTTAGTGGAGAGGAGGAGAGG + Intronic
1098065763 12:66614499-66614521 GTGTAAGTGGTGAGAAGGAATGG - Intronic
1098146198 12:67499986-67500008 AGGTTAGTGGGGAGAAAGGATGG + Intergenic
1098343329 12:69473786-69473808 AGGTGGGTGGCGAGGAGGAGGGG + Intronic
1098558309 12:71844127-71844149 ATGGTAGTGGGGATGAGGAAAGG - Intronic
1099321448 12:81155390-81155412 AGGTTAGTACTCAGCAGGAAAGG - Intronic
1099727299 12:86448250-86448272 AGGCAAGTGCTGAGAAGGAAAGG - Intronic
1099853986 12:88141598-88141620 TGGGTAGGGGTGTGGAGGAAGGG - Intronic
1100974551 12:100108914-100108936 AGGGTAGTGGTGGGGAGCAGGGG + Intronic
1101380853 12:104212698-104212720 AGGTTAGTGGTTAAGAGCAGAGG + Intergenic
1101539938 12:105655591-105655613 AAGGTAGTGGTGAGGATGAGGGG + Intergenic
1101825280 12:108215664-108215686 AAGATGCTGGTGAGGAGGAAAGG - Intronic
1102188068 12:110965241-110965263 AGGTTTGTGGTGAGAGAGAAGGG - Intergenic
1102797112 12:115698252-115698274 AGGGGAGTGGAGAGGAGGGAAGG + Intergenic
1102822972 12:115923879-115923901 AGGTGAGAAGTGAGGAAGAAGGG - Intergenic
1103231925 12:119338689-119338711 AGGTTTGTTTGGAGGAGGAAAGG + Intronic
1103302330 12:119937630-119937652 AGGAAAGTGTTGAGGAGGAGGGG + Intergenic
1103605699 12:122084442-122084464 AGGTTAGAGGAGAGGATGGAGGG + Intronic
1103606343 12:122088521-122088543 ATCCCAGTGGTGAGGAGGAAAGG + Intronic
1103762534 12:123261991-123262013 AGAGTTGTGGTGAGGAGGGAAGG - Intronic
1105334226 13:19449902-19449924 AGGAAAGAGGAGAGGAGGAAGGG - Intronic
1105860698 13:24409452-24409474 AGGAAAGAGGAGAGGAGGAAGGG + Intergenic
1106037488 13:26057310-26057332 ATGTTAGTGGAGAGGAGAAAGGG - Intergenic
1107488373 13:40854487-40854509 AGGAAAGAGGAGAGGAGGAAGGG - Intergenic
1107507496 13:41049107-41049129 TGGTAAGTGGTGAGGAGGTGGGG - Intronic
1108283357 13:48881461-48881483 AGGAGAATGGAGAGGAGGAAGGG + Intergenic
1108537985 13:51406078-51406100 AGGTTAGGGGTGAGGATGGAAGG - Intronic
1110427567 13:75385722-75385744 AGGATAGTTGTGAGGATTAAAGG - Intronic
1110671642 13:78187141-78187163 AGGTTAGTGGGAAAGAGGAGTGG + Intergenic
1110947438 13:81440440-81440462 AGGGTAGTGGGGAGGAGGGGGGG + Intergenic
1111856186 13:93640731-93640753 AGGAAAGTGGGGAGGAGGGAGGG - Intronic
1111856195 13:93640755-93640777 AGGAAAGTGGGGAGGAGGGAGGG - Intronic
1112203616 13:97302536-97302558 GGGTTAGTTGTGAGGATTAAGGG - Intronic
1112781323 13:102904150-102904172 TGGTGTGTGGTGAGGCGGAAGGG + Intergenic
1113351165 13:109530661-109530683 TGGTGCGTGGTGAGAAGGAAGGG - Intergenic
1113946156 13:114044646-114044668 AGGTTCGTGTTGTGGGGGAAAGG - Intronic
1114447087 14:22797154-22797176 AGGTATGTGGTGTGGTGGAATGG - Intronic
1114649349 14:24274106-24274128 AGGCTGGTGGTGAGGTGGGAGGG - Intergenic
1117050799 14:51857696-51857718 AGTTTGGTGGTGAGAAGGAAAGG + Intronic
1117570734 14:57046294-57046316 TGCTTGGTGGTGAGGAGGATGGG - Intergenic
1117772757 14:59151336-59151358 AGGGTAGTGGCGATGGGGAAGGG + Intergenic
1117850720 14:59965919-59965941 AAGATACTGGTGAGGAAGAAAGG + Intronic
1118110248 14:62710608-62710630 GGGTAAGTGGTGAGTGGGAAGGG - Intronic
1118916491 14:70111865-70111887 AGATGAGGGGAGAGGAGGAAAGG + Intronic
1119733173 14:76964111-76964133 AGGTTAGAGGAAAGGAAGAAGGG + Intergenic
1120346223 14:83294012-83294034 AGGGGAGGGGAGAGGAGGAAGGG - Intergenic
1120700629 14:87695098-87695120 AGGGTAGTGGTGAGGTAGGAGGG + Intergenic
1120796938 14:88644519-88644541 AGAGAAGTGGGGAGGAGGAAAGG + Intronic
1121451686 14:94012262-94012284 AGGGGAGGGGAGAGGAGGAAAGG - Intergenic
1121451697 14:94012287-94012309 AGGGGAGGGGAGAGGAGGAAAGG - Intergenic
1122036099 14:98950408-98950430 AGGGGAGGGGAGAGGAGGAAGGG + Intergenic
1124352100 15:28963417-28963439 AGGTGGGTGGGGAGGATGAAAGG - Intronic
1124448246 15:29759620-29759642 GGGTTAGGGGTGGGGAGGAATGG - Intronic
1124900270 15:33816147-33816169 AGGACAGTGGTGAGGAGGGAAGG - Intronic
1124944164 15:34247683-34247705 AGGATAGTGGAGAGGAAGAAAGG - Intronic
1125539738 15:40463393-40463415 AGGGTAGTGGTGAGGATTAAAGG - Intronic
1125601548 15:40918360-40918382 AGGCCAGGGCTGAGGAGGAAAGG + Intergenic
1125614851 15:41001578-41001600 AGGTCATGGGTTAGGAGGAAGGG + Intronic
1126104555 15:45139037-45139059 AGGTTGGGGGTGGGGAGGAAAGG - Intronic
1126210452 15:46095234-46095256 AGGGAAGTGTTGAAGAGGAAGGG + Intergenic
1126229580 15:46309391-46309413 GGGTGACTGGTGAGGTGGAAGGG - Intergenic
1126561812 15:50052364-50052386 AGCTTGTTAGTGAGGAGGAATGG + Intronic
1126969951 15:54099523-54099545 ACATGAATGGTGAGGAGGAAAGG - Intronic
1127715296 15:61643745-61643767 AGGTTGGTGGAGAGGCAGAAGGG + Intergenic
1127882113 15:63167210-63167232 AGCTTGGAGGTGGGGAGGAAGGG + Intergenic
1128570281 15:68728650-68728672 AGAAAAGGGGTGAGGAGGAAAGG + Intergenic
1128744416 15:70103508-70103530 AGGTGCGGGGTGAGGGGGAAGGG - Intergenic
1128754268 15:70170759-70170781 AGGCTAGGGAGGAGGAGGAAAGG + Intergenic
1129601754 15:77003191-77003213 AGGCTCTGGGTGAGGAGGAAGGG - Intronic
1129879407 15:78996936-78996958 AGGCAAGAGGTGAGGAGGAAAGG + Intronic
1130300978 15:82679897-82679919 AGGGCAGTGGTGAGGAGGCAAGG - Intronic
1130548783 15:84875867-84875889 AGGTGAGGGGGGAGGAGGGAGGG - Intergenic
1130821962 15:87505315-87505337 AAGTTTGTGGTGAGGATAAAGGG - Intergenic
1131455316 15:92578908-92578930 GGGCTAGTGGGGAGGAGGGAAGG - Intergenic
1131605326 15:93897629-93897651 AGGTTAGGGGTGAGAGGGGAAGG + Intergenic
1131638311 15:94261101-94261123 GGGTGGGTGGTGAGGAGGCAGGG - Intronic
1132087000 15:98916744-98916766 AGGTGTGTGGTGGGGAGAAAGGG + Exonic
1132547280 16:539173-539195 AGGGTAGAGCTTAGGAGGAAAGG - Intronic
1132862247 16:2077509-2077531 AGTGGAGGGGTGAGGAGGAAAGG - Intronic
1134170365 16:11963602-11963624 AGGTAAGTGGTGGGGAAGAAGGG - Intronic
1134283730 16:12841593-12841615 AGGTTAGTGGAGAGGAGATAGGG + Intergenic
1135206678 16:20490966-20490988 AAGTTGGGGGTGAGGAGGGAAGG - Intergenic
1135212207 16:20532666-20532688 AAGTTGGGGGTGAGGAGGGAAGG + Intergenic
1135511281 16:23086047-23086069 ATGTTGGTGGAGAGGTGGAAAGG - Intronic
1135538812 16:23314602-23314624 AGGTGAGTGTGGAGGAGGAGGGG + Intronic
1135621213 16:23957642-23957664 AGGTGAGGGGTGGGGAGGAGGGG - Intronic
1135862673 16:26071251-26071273 AGGTGAGGGGTGAGGGAGAAAGG + Intronic
1135927575 16:26709068-26709090 AGTTGAGTGGAGAGGAGGAGAGG + Intergenic
1137677520 16:50311100-50311122 AGTCTAGTGGTGGGGAGGGAAGG + Intronic
1137785425 16:51134281-51134303 AGGTTAGTGATGAGAGGGAAAGG + Intergenic
1138250758 16:55500004-55500026 AGAGTAGTGGGGAGGAGGGAAGG - Intronic
1139311713 16:66033255-66033277 AGGTTGGTGCTCAGGTGGAATGG + Intergenic
1139379264 16:66520282-66520304 AGGTAAGCGGAGAGGAGGCAGGG - Intronic
1139415086 16:66801550-66801572 AGGTGAGCGGTGATGAAGAAAGG - Exonic
1139499148 16:67346692-67346714 AATTTTGTGTTGAGGAGGAAGGG - Intronic
1140108151 16:71979986-71980008 AGGTTAATGGGAAGAAGGAACGG - Exonic
1140676322 16:77335335-77335357 AGGGTAGTGGGGAGGGAGAATGG + Intronic
1142329548 16:89442687-89442709 TGGTGGGTGGTGGGGAGGAAAGG - Intronic
1142816236 17:2428044-2428066 AGGGGAGGGGAGAGGAGGAAAGG + Intronic
1143510620 17:7393580-7393602 AGGTGAGTGGGAAGGAGGGAGGG - Exonic
1143626079 17:8110766-8110788 AGGTATGAGGTGAGGAGGAGAGG - Intronic
1143704454 17:8687347-8687369 AGGGGAGGGGAGAGGAGGAAAGG - Intergenic
1144249434 17:13400714-13400736 AGGATGGGGGTGAGCAGGAAAGG + Intergenic
1145958800 17:28873381-28873403 AGGGTGCTGGAGAGGAGGAAGGG - Intergenic
1146069793 17:29669491-29669513 AGTTTAGGGAGGAGGAGGAATGG + Intronic
1146232205 17:31122274-31122296 ATGATAGGGGTAAGGAGGAAAGG + Intronic
1146986139 17:37220301-37220323 AGGAGAGTGATGAGGAGGGAAGG + Intronic
1147133177 17:38420553-38420575 AGGAGAGGGGTGAGGAGGAGTGG + Intergenic
1147176580 17:38659533-38659555 AGGTTAATGTAGAGGAGGAAGGG + Intergenic
1148019920 17:44546994-44547016 AGGTTAGCAGTGAGCAGAAAAGG + Intergenic
1148334707 17:46833439-46833461 AGGTGAGTGTTAGGGAGGAAGGG + Intronic
1148614641 17:48991125-48991147 AGGTAAAGGGGGAGGAGGAAAGG + Intergenic
1148826565 17:50398167-50398189 AGGTGAGTGGGGGGGAGGGAGGG - Intergenic
1148905837 17:50911630-50911652 AAGGTAGGGGTGAGGAGGAGGGG - Intergenic
1149133183 17:53332852-53332874 AGGTGATAGTTGAGGAGGAAAGG + Intergenic
1149425584 17:56551381-56551403 GGCTTTGTGGTAAGGAGGAAAGG + Intergenic
1149511279 17:57243748-57243770 AGGGTGGTGGAGAGGAGGAAGGG + Intergenic
1149856010 17:60083523-60083545 TGGTTAAAGGTGAGGAGGAGGGG - Intergenic
1151246382 17:72798114-72798136 GGGTTACTGGTGGGGAGGAGAGG + Intronic
1151770345 17:76156403-76156425 TGGGTAGAGATGAGGAGGAAAGG + Intronic
1152144424 17:78559763-78559785 AGATGAGAGGTGACGAGGAAGGG - Intronic
1155623510 18:27808260-27808282 ATGTCAGTGATGGGGAGGAATGG + Intergenic
1156066653 18:33149700-33149722 ATGTTTGTGGGGAGCAGGAAAGG - Intronic
1156252075 18:35360763-35360785 AGGCTAAGGGAGAGGAGGAATGG + Intergenic
1156353571 18:36322201-36322223 AGGTCAGGTGTGAGGAGGAATGG + Intronic
1157184475 18:45526710-45526732 AAGTTCGTGGGGAAGAGGAAGGG + Intronic
1157615138 18:48982424-48982446 CAGTTAGCGGTGGGGAGGAAGGG - Intergenic
1157712061 18:49857027-49857049 AGGTGACAGGAGAGGAGGAAGGG - Intronic
1159941435 18:74411910-74411932 AAGTGAGTGCTGAGGAGGAAAGG + Intergenic
1160170971 18:76554077-76554099 AGGCTAGGGGTGGGGAGGAGAGG + Intergenic
1161861882 19:6804064-6804086 AGGTTAGTGGAAAGGGGGTATGG + Intronic
1162968394 19:14166347-14166369 AGGTTGGGGGTGGGGAGGACTGG + Intronic
1164441947 19:28285288-28285310 AGGATAGTGGAGGGGAAGAAGGG + Intergenic
1164794394 19:31014558-31014580 AGGTGAGAGGGAAGGAGGAAGGG + Intergenic
1165878268 19:39025027-39025049 AGGTCAGTGGTGCGGAGGGGAGG + Exonic
1165941992 19:39419250-39419272 AGGGTTGTGGTGATGAGTAATGG + Intronic
1166288738 19:41848399-41848421 AGGATAGGGGTCAGGAGAAAGGG + Intronic
1166686090 19:44797114-44797136 GGGTTTGGGGAGAGGAGGAAAGG - Intronic
1167169106 19:47819516-47819538 ATGTAAGTGGTGAGGAGAAAGGG + Intergenic
1167413877 19:49360600-49360622 AAGTTAGTGGTGGGGAAGGAAGG + Intronic
1167699541 19:51034463-51034485 AGCCTGGTGGTGAGGAGGAGAGG - Intronic
925165724 2:1714455-1714477 GGATTGGTGGTGATGAGGAAGGG - Intronic
925790369 2:7478781-7478803 AGATTTGTGGTGAGAAGGAGCGG + Intergenic
926179148 2:10625109-10625131 GGGTTTGTGGGGTGGAGGAAGGG + Intronic
926220120 2:10930675-10930697 AGGCTTGTGGTGAGGATGAACGG + Intergenic
927840771 2:26441903-26441925 TGGGTGGTGGTGAGCAGGAAAGG - Intronic
928167878 2:28983921-28983943 AGGAAAGAGGTGAGGAAGAATGG - Intronic
930384481 2:50676407-50676429 AGATTAGTGGTTAAGAGGATAGG + Intronic
931132628 2:59354383-59354405 AGGGTAGTTGTGAAGATGAAAGG - Intergenic
931509337 2:62973444-62973466 AGTTTAGTGGTTAAGAGCAAGGG + Intronic
931973414 2:67615673-67615695 AGTATAGTGGTTAAGAGGAATGG - Intergenic
931995559 2:67836143-67836165 AGGAGAGTAGTGAGGAAGAAAGG + Intergenic
932291252 2:70581881-70581903 ATATGACTGGTGAGGAGGAAGGG - Intergenic
934479666 2:94623760-94623782 AGGTGAGGGGAGAGGAGGTAGGG + Intergenic
935015469 2:99177840-99177862 AGGGCAGTGGGTAGGAGGAATGG - Intronic
935673068 2:105571972-105571994 AGGTGAGTGGGGAGAGGGAAAGG - Intergenic
936922762 2:117706378-117706400 AGATTAGTGGTTGGTAGGAAAGG - Intergenic
937147945 2:119663444-119663466 GGGCTCATGGTGAGGAGGAAGGG - Intergenic
937845366 2:126573447-126573469 TGGTTCAAGGTGAGGAGGAAGGG - Intergenic
938565798 2:132517299-132517321 AGGTTAGTTGGGGGAAGGAAAGG + Intronic
939162651 2:138608064-138608086 AGATTGGAGGGGAGGAGGAAGGG - Intergenic
939291033 2:140195053-140195075 AGGTTAGTAATGAGGATGAGAGG + Intergenic
939469026 2:142596095-142596117 AGGATAGCGGAGAGGAGGATAGG - Intergenic
940281036 2:151989894-151989916 AAGTCAGTGGAGAGGGGGAAGGG - Intronic
940317748 2:152342658-152342680 AGGTTTCTGGAAAGGAGGAAGGG - Intronic
941152437 2:161931418-161931440 AGGTTGCTGTTGAGGATGAATGG + Intronic
941892315 2:170595173-170595195 AGGGTTGTGGTGAGGAGTAAAGG + Intronic
942212285 2:173683436-173683458 AGGGAAGTGGTGGGGAGGCAGGG + Intergenic
944014473 2:195018119-195018141 AGGTGAGTGGTGAGAAGGCAGGG + Intergenic
944017619 2:195062620-195062642 AGGTCATTGTAGAGGAGGAAAGG - Intergenic
944282720 2:197916477-197916499 AGGGTTGTTGTGAGGAGGAAAGG + Intronic
944450174 2:199834516-199834538 AGCTTTATGGTGAGGAGGAGTGG - Intronic
944494385 2:200291610-200291632 AGGGTTGTGGGGAGGAGGAATGG - Intergenic
944657604 2:201891567-201891589 AGGGTAATCTTGAGGAGGAAGGG + Intronic
944961736 2:204882748-204882770 AAATCAGTGATGAGGAGGAAGGG - Intronic
945595596 2:211786762-211786784 AGGGTAGTGGTGGGGAGGTGTGG - Intronic
945741092 2:213662156-213662178 AGGTGAGGGGTGAGGGGGAGGGG + Intronic
946073425 2:217053789-217053811 AGGTGAGGGGGGATGAGGAAAGG - Intergenic
946095266 2:217269380-217269402 AGGTTACTGATGAGATGGAAGGG + Intergenic
947375306 2:229489517-229489539 AGGAAGGTGGTGAGGAGGAGGGG + Intronic
947460229 2:230297831-230297853 AAGTAAGTGGTGTGGATGAAAGG + Intronic
948055646 2:235007777-235007799 TGGGTAGTGCTGAGGAGGCAGGG + Intronic
948272804 2:236687184-236687206 AGGATAGTGGTGATTGGGAAGGG + Intergenic
948887684 2:240892313-240892335 AGGTGAGTTCTGGGGAGGAAAGG - Intronic
1168960064 20:1862898-1862920 AAGTTGGTGGAGAGGAGGGAAGG - Intergenic
1169899128 20:10535040-10535062 AGGTTTGGGGTGTGGAGGCAGGG + Intronic
1170041608 20:12045277-12045299 AGGGAAGGGGTGAGGAGGGAAGG - Intergenic
1170041614 20:12045292-12045314 AGGGAAGGGGTGAGGAGGGAAGG - Intergenic
1170041620 20:12045307-12045329 AGGGAAGGGGTGAGGAGGGAAGG - Intergenic
1170041626 20:12045322-12045344 AGGGGAGGGGTGAGGAGGGAAGG - Intergenic
1170299191 20:14863387-14863409 AGGGCAGGGGTGAGGAGTAAAGG + Intronic
1170559489 20:17544401-17544423 AGGTGAGTGCTGAGGGGGTACGG + Intronic
1170876383 20:20254023-20254045 AGGGGAGTGGAGGGGAGGAAAGG - Intronic
1170876398 20:20254058-20254080 AGGGGAGTGGAGGGGAGGAAAGG - Intronic
1170876413 20:20254093-20254115 AGGGGAGTGGAGGGGAGGAAAGG - Intronic
1171200068 20:23233529-23233551 AGGTGAGGGGTGAGGAGGGGAGG + Intergenic
1171266625 20:23776472-23776494 AGGAGAGTAGTGAGGAGGAGGGG - Intergenic
1171276174 20:23858108-23858130 AGGAGAGTAGTGAGGAGGAGGGG - Intergenic
1171817654 20:29802616-29802638 AGGTTAGTTTTGAGGCTGAATGG + Intergenic
1171885024 20:30645902-30645924 AGGGTGGTGGTTAGTAGGAAGGG - Intergenic
1172779853 20:37430086-37430108 AGGTGGGTGGAGAGGAGGATGGG - Intergenic
1172995950 20:39070499-39070521 AGGGTAGGGGTAAGGAGAAAAGG - Intergenic
1173065090 20:39703031-39703053 AGGGTAGGGGAGAGGAGGAGAGG + Intergenic
1173873776 20:46357308-46357330 AGATAAGTGGTGAGCAGGCAGGG - Intronic
1173891897 20:46519206-46519228 AGGGTGGTGCAGAGGAGGAAGGG + Intergenic
1174102851 20:48140287-48140309 AGTTTAGTGGTGAGGTGGTGGGG - Intergenic
1174117079 20:48233780-48233802 TGGTGAGAAGTGAGGAGGAAGGG + Intergenic
1174189173 20:48728054-48728076 AGGGTGGTGTTGAGGAGGAATGG - Intronic
1174610954 20:51798562-51798584 AGGCTAAAGGTGATGAGGAAGGG + Intronic
1174782223 20:53400467-53400489 AGGGCAGTGGTGAGGACTAAAGG - Intronic
1175992640 20:62797059-62797081 CGGTGAGCGGTGAGGAGAAAGGG - Intronic
1176738832 21:10578757-10578779 AGGAAAGAGGAGAGGAGGAAGGG + Intronic
1177527420 21:22312740-22312762 AGGGAAGTGGTGAGCAAGAAAGG - Intergenic
1177769468 21:25498321-25498343 AGCCTAGTGGTGGGGAGAAAAGG + Intergenic
1177926420 21:27221670-27221692 AGGAAAGAGGTGAGGAGAAAAGG + Intergenic
1178498178 21:33104343-33104365 AGGGAAGTGGGGAGCAGGAAGGG + Intergenic
1178634779 21:34292611-34292633 AGGCTAGTGGTGGGGAAGAGAGG + Intergenic
1178693206 21:34767124-34767146 AAGTTAGTGGCTGGGAGGAAGGG + Intergenic
1178810321 21:35875921-35875943 CTGTTAGTGGGTAGGAGGAAAGG + Intronic
1179030130 21:37712799-37712821 AGTTGGGTGGGGAGGAGGAAGGG - Intronic
1179629451 21:42667526-42667548 AAGAGAGTGGTGAGGAGGGAGGG + Intronic
1180713830 22:17858189-17858211 AGGTAAGCGGTGAGGAGACAAGG + Intronic
1181054235 22:20252598-20252620 AGGATAGTGGTGATGAAGATGGG - Intronic
1181744511 22:24946523-24946545 AGGTGAGGAGTGAGGAGGGAAGG - Intronic
1182100689 22:27655545-27655567 AGGATGGTGGATAGGAGGAAGGG + Intergenic
1182980429 22:34665665-34665687 TGGTTATTGGAGAGGAGAAATGG - Intergenic
1183339830 22:37274054-37274076 GGGTGAGCGGTGGGGAGGAAAGG - Intergenic
1183368180 22:37418103-37418125 AGGTAAAGGGAGAGGAGGAATGG + Intronic
1183388510 22:37529272-37529294 AGGTTCGTCGTGGGGAGGAAAGG - Intergenic
1184428276 22:44425761-44425783 AAGGGAATGGTGAGGAGGAAGGG + Intergenic
1185205952 22:49538892-49538914 AGGGTAGGGGGCAGGAGGAATGG - Intronic
949577120 3:5349229-5349251 AAGTTAGTGCTGAGGACGACTGG - Intergenic
950128758 3:10527639-10527661 AGGGCAGTGGTGGGGAGGTAGGG - Intronic
950767693 3:15285668-15285690 ATGTTAGTGGTGAGGACTCACGG - Intronic
951063824 3:18240906-18240928 ATGTAAGTGTGGAGGAGGAAAGG - Intronic
951350141 3:21596873-21596895 AAGTTAATGGTGGAGAGGAAAGG + Intronic
952420867 3:33130444-33130466 AAGCTAGTGATAAGGAGGAAGGG - Intronic
952946027 3:38478321-38478343 AGGATAGAGGTGGGGAGGACAGG + Intronic
953703073 3:45211462-45211484 TGGTTAGTGGGGAGGGGGGATGG + Intergenic
954521176 3:51228105-51228127 AGGTAAGGGGTGGGGATGAAAGG - Intronic
954573965 3:51664559-51664581 AGGTTAGGGGTAAGGAGGGTAGG + Exonic
954781980 3:53068471-53068493 AGGGTTGTGGTGAGGATTAAAGG - Intronic
955346869 3:58167970-58167992 GGGTGAGGGCTGAGGAGGAAGGG + Intronic
955405102 3:58620943-58620965 AGGTGAGTGTAGAGGAGGAGTGG - Intronic
956489711 3:69757843-69757865 AGGATAATGGGGAGCAGGAAGGG + Intronic
956651536 3:71508923-71508945 AGGATTGTGGTGAGGACAAAAGG + Intronic
957642007 3:82866442-82866464 AAGTTAGTGGTGAGGTGAAGTGG + Intergenic
957828391 3:85481607-85481629 GGGTTGGGGGTGAGGAGGTATGG + Intronic
959067472 3:101673153-101673175 AGGGTAGGGGTGAGGAGGCAGGG + Intronic
959678434 3:109064888-109064910 AGTGTAGAGGTTAGGAGGAATGG - Intronic
960045521 3:113193602-113193624 AGGTGGGTGGGGAGGAGAAAAGG + Intergenic
961131252 3:124469286-124469308 AGGTTAGGGATGAAGAGGAAAGG - Intronic
961159744 3:124713676-124713698 GGGGTAGTGGTGGGGAGAAAGGG - Intronic
961406276 3:126682059-126682081 AGTCTTGTGGTGAGGAGGCAGGG + Intergenic
961721367 3:128898850-128898872 AGGGTGGTGAGGAGGAGGAAAGG - Intronic
962200735 3:133399418-133399440 AGGACAGAGATGAGGAGGAAAGG + Intergenic
962635837 3:137330508-137330530 AGGTTTGTGGGGAGGAGGCTTGG + Intergenic
962654480 3:137529351-137529373 AGGTTTGTGGGGAGTAGCAATGG - Intergenic
962865924 3:139448020-139448042 AGGGGAGAGGTGAAGAGGAAGGG - Intergenic
963078789 3:141372204-141372226 AGGATGGAGCTGAGGAGGAATGG + Intronic
964698786 3:159540108-159540130 AGGGAAGTGGGGAAGAGGAAGGG - Intronic
965526526 3:169725325-169725347 AGCACAGTGGGGAGGAGGAATGG - Intergenic
965628694 3:170708228-170708250 AGGTAAGTGAGGAGGAAGAAGGG + Intronic
965801507 3:172498523-172498545 AGGTTAGTGGCCAGGAGCAGTGG + Intergenic
967348819 3:188489319-188489341 AGGTTAGTGGTGGAGAGTGAGGG + Intronic
969247610 4:5945671-5945693 AGGTTGATGGTTAGGAGGCAGGG - Intronic
969473379 4:7403490-7403512 AGGTTGGTGGGGTGGAGGGAAGG + Intronic
969566177 4:7979649-7979671 AGGTGAATGGTTATGAGGAAAGG - Intronic
972191578 4:36598523-36598545 TGGTTACTGGTGGGGAGGAAAGG + Intergenic
972882931 4:43447888-43447910 AGGCTAGGGGAGAGAAGGAAGGG + Intergenic
973565555 4:52183505-52183527 GGGTTTGGGGTGAGAAGGAATGG + Intergenic
974326565 4:60422246-60422268 AGGGGAGGGGAGAGGAGGAAAGG + Intergenic
975504502 4:75123058-75123080 AGGGTAGGGGAGAGGAGGGAAGG + Intergenic
976289767 4:83405575-83405597 AGATTAGAGGTGAGGGGGCAGGG - Intergenic
976753729 4:88477238-88477260 AGGGGAGGGGAGAGGAGGAAGGG + Intronic
977917948 4:102614364-102614386 CGGAGAGTGGGGAGGAGGAACGG - Intronic
977919216 4:102625178-102625200 AGGAGGGAGGTGAGGAGGAAGGG - Intergenic
977989517 4:103423799-103423821 AGGTTAGTGGTGGGGAGTGCAGG + Intergenic
979640910 4:123012087-123012109 AGGAAAGTGGAGAGAAGGAAGGG + Intronic
979640986 4:123012342-123012364 AGGAAAGTGGAGAGAAGGAAGGG + Intronic
980239253 4:130152245-130152267 AGGGTAGTGGGGAGAAGGGAGGG + Intergenic
980506428 4:133730133-133730155 AGGTAACTGCTGAGGAGGATGGG - Intergenic
980579218 4:134728061-134728083 AGGAAAGTGGGAAGGAGGAAAGG + Intergenic
981474353 4:145173547-145173569 AGGGAAGTGGGGAGGTGGAATGG - Intronic
981509571 4:145541108-145541130 AGGTTAGTGGTGAGGAGGAAGGG - Intronic
982228537 4:153187513-153187535 AGGTTAGAGGAGTGCAGGAATGG + Intronic
983257544 4:165417151-165417173 GGGTGAGTGGGGTGGAGGAATGG + Intronic
983281035 4:165681039-165681061 AGGCTAGGAGTGTGGAGGAAAGG + Intergenic
983627130 4:169813146-169813168 AGCTTAGTGGTTAAGAGGATAGG + Intergenic
984025663 4:174540153-174540175 AGGTTGTTGGTGTGGAGCAAAGG - Intergenic
984333813 4:178361419-178361441 AGGTGAGTTGAAAGGAGGAAGGG - Intergenic
984677671 4:182568978-182569000 GGAGTAGTGGGGAGGAGGAAGGG + Intronic
985271266 4:188197004-188197026 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
985271425 4:188197604-188197626 AGGTGGGTGGGGAGGGGGAAGGG - Intergenic
986028657 5:3874586-3874608 GAGTTAGGGGTGAGGGGGAAAGG + Intergenic
986808522 5:11331769-11331791 ACTTTAGTGGGGAGGAGGGATGG + Intronic
986859272 5:11906234-11906256 AAGTCAGTGGGGAGGTGGAAAGG + Intergenic
987039529 5:14048741-14048763 AGCTTAGTGGTGAAGAAGAGTGG - Intergenic
988529100 5:32011650-32011672 AGGAGAGTGGGAAGGAGGAAGGG - Intronic
989264974 5:39463140-39463162 AGGTTTGTGGTGAAGATTAATGG - Intergenic
990209563 5:53468090-53468112 GGGTTAGGGGAAAGGAGGAATGG + Intergenic
990704215 5:58509628-58509650 AGGAGAGTGGGGAGGAGGATAGG + Intergenic
990876721 5:60494550-60494572 GGGGTAGAAGTGAGGAGGAAAGG - Intronic
991907602 5:71527428-71527450 AGGTTAGGGGGTGGGAGGAATGG - Intronic
992225062 5:74612253-74612275 AGGCTAGTGCTGAGGAGGTGGGG - Intergenic
993045197 5:82858522-82858544 AGGGTATTGATGGGGAGGAAGGG + Intergenic
993367439 5:87050694-87050716 AGGCTAGGGGAGAGGAGGCAGGG + Intergenic
993461778 5:88191121-88191143 AGATTTGTGGTCAGGATGAAGGG - Intronic
993699282 5:91099292-91099314 AAGGAAGTGGTGAGGAGAAAGGG - Intronic
993773288 5:91959047-91959069 AAGTTACTGGAGAAGAGGAAAGG + Intergenic
995703068 5:114957394-114957416 GGGTTGGTGGTGGGAAGGAAAGG - Intergenic
996184775 5:120462515-120462537 AGGATATGGGAGAGGAGGAAAGG - Intergenic
996236109 5:121131788-121131810 AAGTTAGTGGTTGGGAGAAAAGG + Intergenic
996886088 5:128355032-128355054 AGGTTAAAGGTTAGGAGGATAGG + Intronic
997356019 5:133263443-133263465 AGGGTAGGGCTGAGGAAGAAGGG + Intronic
997427152 5:133811244-133811266 GGGGAAGTGGTGAAGAGGAAAGG - Intergenic
997935884 5:138110584-138110606 AGGTTAGTGGAGGTGGGGAATGG + Intergenic
997962871 5:138335915-138335937 AGCTTAGTGGTGAAAAGCAAGGG + Intronic
998005287 5:138652683-138652705 TGCTTAGTGGTGATGAGAAACGG + Intronic
998052047 5:139043914-139043936 ATTTCAGAGGTGAGGAGGAAGGG + Intronic
998209190 5:140181332-140181354 AGGGTGGTGTTGGGGAGGAAAGG - Intronic
998417317 5:141955387-141955409 AGGGTCGGGGTGAGGTGGAAGGG + Exonic
999070265 5:148736956-148736978 AGGCTAGTGGGCAGGAGGACAGG - Intergenic
999541360 5:152576017-152576039 AGCTAAATGGTGAGGAGGAATGG + Intergenic
1001172893 5:169438044-169438066 AGGGTAGTGGTGAGGAGGGCAGG + Intergenic
1001309723 5:170602261-170602283 AGGGAAGTGGTGAGTGGGAAGGG - Intronic
1001514783 5:172347754-172347776 AGGGCAGCGGTGAGGATGAAAGG + Intronic
1001562641 5:172679326-172679348 AAGATAGTGGTGAGGACCAAAGG + Intronic
1001684593 5:173584010-173584032 AGGAAAGTGGTTAGGAGGGAAGG - Intergenic
1002323958 5:178393367-178393389 AGGGCTGTGGGGAGGAGGAATGG + Intronic
1002452331 5:179325986-179326008 AGCTGAGGGGTGCGGAGGAAGGG + Intronic
1003228489 6:4227879-4227901 AGGGTAGTGGGAAGGAGGGAGGG + Intergenic
1004931941 6:20470822-20470844 AGCTTCGTGGTGGGGAGGGAAGG - Intronic
1006191376 6:32211644-32211666 AGGTATGTGAGGAGGAGGAAGGG + Intronic
1006470875 6:34227822-34227844 AGGTTCGGGGTGAGGACGCAGGG + Intergenic
1007280372 6:40707968-40707990 ATTTTAGGGGTGAGGAGAAAAGG + Intergenic
1007482448 6:42158923-42158945 GGGTTAGTGGGGAGCAGGGATGG + Intronic
1007593221 6:43035989-43036011 GGGCTACTGGGGAGGAGGAAAGG - Intergenic
1007712983 6:43836361-43836383 TGGAGAGTGGGGAGGAGGAAGGG + Intergenic
1008445158 6:51580677-51580699 AGGCTAGTGGTGAAGAAAAAGGG + Intergenic
1008955003 6:57205902-57205924 AGCAGAGTGGAGAGGAGGAAGGG + Intronic
1009344764 6:62599974-62599996 AGGTGTGTGGTCAGGAGGGAAGG + Intergenic
1009865673 6:69394744-69394766 AGGTTAGTGGATAGTGGGAAGGG - Intergenic
1010457430 6:76074007-76074029 AGGATAGTGGTGAAGAGTATAGG - Intergenic
1012445107 6:99299108-99299130 ATGTTAGTGGAGACTAGGAATGG - Intronic
1012688800 6:102287697-102287719 AGGTAGGTGGTGAAGAGGAAGGG + Intergenic
1014178762 6:118360300-118360322 AGGTTAATGTTGAGTAGAAATGG - Intergenic
1014688807 6:124535871-124535893 AGGGAAGCAGTGAGGAGGAAGGG - Intronic
1014708667 6:124780188-124780210 GGGAGAGTGGTGAGGATGAAAGG + Intronic
1015704640 6:136074563-136074585 AGTGTAGTGGGAAGGAGGAATGG - Intronic
1016405203 6:143722744-143722766 AGGGTAGTGGGGAGGAGGGATGG - Intronic
1016984812 6:149887233-149887255 AGGGGATTGGTGAGTAGGAAGGG - Intronic
1017026415 6:150185240-150185262 AGGGTAGTTGTGAGGATGAAGGG + Intronic
1017293235 6:152765590-152765612 AGGTTAGGGGAGGGGAGGGAAGG - Intergenic
1017433730 6:154396146-154396168 AAGTTAATGGTGGGGAGGTAAGG - Exonic
1017862142 6:158408691-158408713 AGGTCAGTGGTGAGGAAGGCGGG - Intronic
1018032753 6:159855668-159855690 AGGTAGGGGGTGAGGAGGATAGG - Intergenic
1018541049 6:164879570-164879592 AGTTTAGTAGTCAGGCGGAATGG - Intergenic
1018726134 6:166614751-166614773 AGGTTACAGGGGTGGAGGAAGGG - Intronic
1018919462 6:168161296-168161318 AGGTCACTCGTGAGGAGGCAAGG + Intergenic
1019278630 7:188904-188926 AGCTGTGTGGTGAGGACGAAGGG - Intergenic
1021344513 7:19508663-19508685 AAGATGGTGGTAAGGAGGAAAGG + Intergenic
1022262451 7:28719570-28719592 AGGTTTGTTGTGAGAGGGAAAGG - Intronic
1022594397 7:31698386-31698408 AGGTAAGTGGTGAAGACGAAGGG - Intronic
1022947839 7:35304898-35304920 ATGTGATTGGGGAGGAGGAAAGG - Intergenic
1023387212 7:39671031-39671053 AGATTAGTTGTGAGGGGTAAAGG - Intronic
1023984463 7:45086810-45086832 AGGGCAGTGGTGGGCAGGAACGG + Intronic
1024561786 7:50650658-50650680 AGGTGAGTGCTGATGGGGAATGG + Intronic
1024635564 7:51287101-51287123 ATGTTGGAGGTGGGGAGGAAAGG + Intronic
1024864599 7:53890684-53890706 AGCTTAGAGGTTAGGAGTAAAGG - Intergenic
1024894597 7:54243206-54243228 AGGTGAGGGGTGAGCATGAAGGG + Intergenic
1028693927 7:93686312-93686334 ATGTTAGTAGGGAGGAGTAAAGG - Intronic
1030897850 7:115084083-115084105 AGGCCAGTAGTGAGGAGGGAGGG + Intergenic
1031817545 7:126456648-126456670 GGGATATTGCTGAGGAGGAAAGG + Intronic
1032613600 7:133442548-133442570 AGGCTAGTGGGGATGGGGAATGG + Intronic
1032774838 7:135101548-135101570 CGGGTGGTGGTGAGGATGAAAGG - Intronic
1033457748 7:141517818-141517840 AGGTTCGTGGTCAGGAAAAAGGG + Intergenic
1033706841 7:143897280-143897302 AGGCTAAGGATGAGGAGGAAGGG - Intronic
1034387127 7:150749147-150749169 AGGTTAGGGGTGGGGAGTAGGGG + Intronic
1034458878 7:151187143-151187165 AGGGGAGTGGGGAGGAGGAGAGG + Exonic
1034547524 7:151798893-151798915 TGGTGAGAGGTGAGGAGGGAGGG - Intronic
1035460356 7:159034845-159034867 CGGCTTGTGGGGAGGAGGAATGG + Intronic
1035542314 8:450914-450936 GGGCTGGTGGGGAGGAGGAATGG - Intronic
1036392662 8:8338016-8338038 AGGTAGGGGGTGAGGAGGAGAGG - Intronic
1037010371 8:13834928-13834950 GGGTTAGTTGTGATGAGAAAGGG - Intergenic
1037913871 8:22760300-22760322 AATTTAGTGGTTAGGAGGGAGGG - Intronic
1038393168 8:27223976-27223998 ATGTGAGTGGAGTGGAGGAAAGG - Intergenic
1038492332 8:27980266-27980288 AGGTCTGTGGTGAGGAGAACTGG + Intronic
1038509249 8:28115465-28115487 ACCTTAGAGCTGAGGAGGAAAGG + Intronic
1039458451 8:37724106-37724128 GGGAAAGTGGTGAGGAGGAAGGG - Intergenic
1039576210 8:38626029-38626051 AGTTCAGTGGGGCGGAGGAAAGG - Intergenic
1039777771 8:40753532-40753554 AGGATAGTGGTGGGGGGGAATGG - Intronic
1040060012 8:43095853-43095875 AGGTTAGGGGTAAGGAGGGTTGG + Intronic
1040694498 8:49979513-49979535 AGGGAAGGGGTGAGGAGGATCGG - Intronic
1041110701 8:54479877-54479899 AGTGTAGTGGGGAGGTGGAAGGG + Intergenic
1041662579 8:60413896-60413918 AGATTAGTGGAGAGGAAGAAAGG + Intergenic
1042441704 8:68835339-68835361 GAGTTAGGGGAGAGGAGGAAGGG + Intergenic
1043390494 8:79786957-79786979 GGGTTTGTGAGGAGGAGGAAAGG + Intergenic
1044370337 8:91402888-91402910 AGATGGGTGGTGAGGGGGAATGG + Intergenic
1044929618 8:97239367-97239389 AGGCAAGAGGGGAGGAGGAATGG + Intergenic
1045236441 8:100356480-100356502 AGGGTAGTGGGGGGCAGGAAAGG + Intronic
1045701517 8:104871830-104871852 AGGTTAGAGGTAAGGAAGATGGG + Intronic
1046254487 8:111678698-111678720 AGACTAGTGGTGAGGAGGGATGG - Intergenic
1046462911 8:114566518-114566540 AGGGTAGTGGGGGGTAGGAAGGG - Intergenic
1047023490 8:120802825-120802847 AGGTTTGTTCTGAGGAGTAAAGG - Intronic
1047844917 8:128794999-128795021 AGGTGGGTGGTGAGGGGGATGGG + Intergenic
1048591780 8:135827062-135827084 AGGAAAGTGGTAAAGAGGAAAGG + Intergenic
1048618343 8:136104131-136104153 AGGGTAGGGGTGAGGAGAAGGGG - Intergenic
1050037652 9:1454240-1454262 AGTGTAGTGGTGCTGAGGAAAGG + Intergenic
1050937441 9:11415629-11415651 AGGTATGTGGTAATGAGGAATGG - Intergenic
1051871764 9:21746133-21746155 AGATTAGTGCTGGGGAGGATGGG - Intergenic
1052789656 9:32863415-32863437 AGGCTAGTGTTGGGGAGGGATGG - Intergenic
1057185007 9:93052640-93052662 AGGAAAGTGGAGAGCAGGAAGGG - Intergenic
1057420716 9:94910161-94910183 GGACTAGAGGTGAGGAGGAAAGG - Intronic
1058594168 9:106597350-106597372 AGCTGAGTGGTGAGGAAGGAAGG + Intergenic
1059749240 9:117232336-117232358 ACCTTAGTGGGGAGGAGTAAAGG - Intronic
1060404138 9:123364776-123364798 AGGGTGATGGTGAAGAGGAAGGG - Intronic
1060531311 9:124348446-124348468 TGGATAATGGTGAGGAAGAAAGG + Intronic
1060691074 9:125660813-125660835 AGGGTTGGGGTGAGGAGGCAAGG - Intronic
1061121289 9:128644144-128644166 AGGGTGGTTGTGAGGAAGAAAGG - Intronic
1062097341 9:134710159-134710181 AGGCTTGTGGTGCGGATGAAAGG + Intronic
1203369311 Un_KI270442v1:287878-287900 AGGTTAGTTTTGAGGCTGAATGG + Intergenic
1186000848 X:5008447-5008469 ATGTTAGGGGTGAGGTGGGAGGG - Intergenic
1186863332 X:13694751-13694773 GGTATAGTGGTGAGGAGAAAAGG + Intronic
1187030532 X:15483500-15483522 AGGTGAGAGGAGAGGAGAAAAGG - Intronic
1187647580 X:21365298-21365320 AGACTACTGGTGAGGAGGCATGG - Intergenic
1189679756 X:43503617-43503639 AGGTTATTTGGGAAGAGGAAAGG - Intergenic
1190003182 X:46709013-46709035 TTGTAAGTGGTAAGGAGGAAAGG + Intronic
1190098544 X:47502578-47502600 GGGTAAATGATGAGGAGGAAAGG + Intergenic
1191675475 X:63787915-63787937 AGATTGGTGGCTAGGAGGAAGGG - Intergenic
1192047351 X:67689953-67689975 AGGAAAGTGGGAAGGAGGAAAGG - Intronic
1192139246 X:68633547-68633569 AGCTTAGTAGTGAGGAGAAAGGG + Intergenic
1192271905 X:69588802-69588824 GGGTTACTATTGAGGAGGAAGGG - Intergenic
1194540519 X:95164672-95164694 AGGTTAGTTGTCAGCAGGAGGGG + Intergenic
1194624404 X:96212210-96212232 AAGTTAATGGTGAAGAGAAAAGG + Intergenic
1195981997 X:110589018-110589040 AGCCTAGTGGTTAGGAGCAAAGG + Intergenic
1196254759 X:113503932-113503954 AGGTAAGGGGATAGGAGGAATGG + Intergenic
1196463394 X:115950830-115950852 AGGTCAGGTGTGAGGAGGACAGG - Intergenic
1197162909 X:123344274-123344296 AGGTTAGTGCTGAGGGGATATGG - Intronic
1199800554 X:151247109-151247131 AGGTTAATTGAGAGGAGGAAAGG + Intergenic
1200266516 X:154649128-154649150 AGGTTGGTGAGGAGGGGGAATGG - Intergenic