ID: 981509572

View in Genome Browser
Species Human (GRCh38)
Location 4:145541109-145541131
Sequence CAGGTTAGTGGTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 448}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509572_981509580 -3 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG 0: 1
1: 0
2: 2
3: 29
4: 448
Right 981509580 4:145541129-145541151 CTGTATGATGGGCAGGTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 148
981509572_981509578 -10 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG 0: 1
1: 0
2: 2
3: 29
4: 448
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509572_981509581 2 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG 0: 1
1: 0
2: 2
3: 29
4: 448
Right 981509581 4:145541134-145541156 TGATGGGCAGGTTAGTGGTGAGG 0: 1
1: 0
2: 0
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509572 Original CRISPR CAGGTTAGTGGTGAGGAGGA AGG (reversed) Intronic
900251994 1:1675703-1675725 CATGTTGGTGATGAGGAGGTGGG - Intronic
900262405 1:1738561-1738583 CATGTTGGTGATGAGGAGGTGGG - Intronic
902723096 1:18317283-18317305 CAGGATTGTGGTGAGGAGTGAGG - Intronic
902837334 1:19055299-19055321 GAGGTTAGTGGAAGGGAGGAGGG - Intergenic
904385673 1:30140573-30140595 GAGGATGGTGGTGGGGAGGATGG - Intergenic
904493921 1:30876482-30876504 CAGGGGAGGGATGAGGAGGATGG - Intronic
906065223 1:42975651-42975673 CAGGGCTGTGGTGAGGATGAAGG + Intergenic
906104614 1:43284432-43284454 CAGGTTGGATGTGAGGAGGTTGG - Intronic
906145359 1:43557310-43557332 CAGGCCTGGGGTGAGGAGGACGG + Intronic
906711926 1:47937072-47937094 CATGGTAGTGGTGATGATGATGG - Intronic
906711942 1:47937195-47937217 CATGGTAGTGGTGATGATGATGG - Intronic
906782675 1:48586460-48586482 CAGGTGAGGAGGGAGGAGGAGGG + Intronic
907850049 1:58247764-58247786 GAGGGTGGTGGTGAGGAGAAGGG - Intronic
907898905 1:58719617-58719639 GAGGTGAGGGGTGGGGAGGAGGG + Intergenic
907956495 1:59233002-59233024 GAAGTTAGAGATGAGGAGGAAGG + Intergenic
908884541 1:68773311-68773333 CAGGAGAGTGATGAGGAGGATGG - Intergenic
909417848 1:75427603-75427625 CAGTTTAGTGGTTAAGAGCATGG + Intronic
910206239 1:84751602-84751624 CAGGGTGGTGGTGGGGAGGAGGG - Intergenic
910561932 1:88600275-88600297 CAGGTTAGGGGAGAGAAGGCAGG - Intergenic
911101927 1:94102122-94102144 CAGGATTGTTGTGAGGAGTAAGG + Intronic
911273690 1:95834749-95834771 AAGGTTCGTGGGGAGGGGGAGGG - Intergenic
911326460 1:96474698-96474720 CTGGTTATTTGTGAGAAGGAGGG + Intergenic
912688628 1:111786785-111786807 CAGGAGACTGGTGAGCAGGAAGG + Intronic
913424572 1:118713143-118713165 CAGTTTACTGTTGAGGATGATGG + Intergenic
913670741 1:121095331-121095353 GAGATTGTTGGTGAGGAGGAGGG - Intronic
914022504 1:143882754-143882776 GAGATTGTTGGTGAGGAGGAGGG - Intergenic
914660990 1:149790696-149790718 GAGATTGTTGGTGAGGAGGAGGG - Intronic
914901420 1:151713223-151713245 CAGGGTGGGGGTGAGGAAGAAGG - Intronic
915323025 1:155066461-155066483 CAGCTTAGATGTGAGAAGGAGGG - Intronic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915606891 1:156957870-156957892 CTGGTTAGAGGCTAGGAGGAGGG + Intronic
915681294 1:157584273-157584295 CAGATTAGGGGAGAGGAAGAAGG - Intronic
915689122 1:157669682-157669704 CAGGTTATTGGAGTGAAGGAGGG - Intergenic
915754922 1:158250197-158250219 CAGGGTAGTGGTGGACAGGAGGG + Intergenic
916047752 1:161013479-161013501 AGGGTGAGTGGTGGGGAGGAAGG - Intronic
916454969 1:164961701-164961723 CAGGCCAGGTGTGAGGAGGAGGG - Intergenic
917056189 1:170984541-170984563 CAGGATACTGGAGTGGAGGATGG - Intronic
917328157 1:173854636-173854658 CAGGGTAGTGGTTAGGAGCATGG - Intronic
918399866 1:184152790-184152812 CAGCTCAGTGGGGATGAGGAAGG - Intergenic
919261714 1:195204429-195204451 CAGTTTAATGGGGTGGAGGAAGG + Intergenic
919311224 1:195912484-195912506 CAGGTTAGTGATGAGTGGCAAGG - Intergenic
919673660 1:200360609-200360631 CAGGTTAGTGGTTAAAAGGATGG + Intergenic
920074280 1:203325465-203325487 CAGGCTAGGGGTGGGGAGGGAGG - Intergenic
920103163 1:203530924-203530946 CAGTTTAGAGGTGAGGAGTGGGG + Intergenic
920166090 1:204037094-204037116 GAGGTGAGTGATGATGAGGAGGG + Intergenic
920350129 1:205332401-205332423 CAGGTGAGAGCTGATGAGGAGGG - Intergenic
920572051 1:207024744-207024766 CAGGAGAGTGGTGAGGAGTGTGG + Intronic
921239814 1:213167216-213167238 CTGGTTAGTGATGAGGGGAAGGG + Intronic
921558562 1:216628843-216628865 CAGGTTACTAGTGATGAAGATGG - Intronic
922209906 1:223478997-223479019 GAGGTTGGGGGTGAGGAGGTTGG + Intergenic
922209912 1:223479012-223479034 GAGGTTGGGGGTGAGGAGGTTGG + Intergenic
922209942 1:223479091-223479113 GAGGTTGGGGGTGAGGAGGTTGG + Intergenic
923546538 1:234927568-234927590 CAGAGTAGAGGTGAGGTGGAGGG - Intergenic
924584911 1:245353703-245353725 CAGGATGGTGGTGGGGAGGGCGG - Intronic
1062823841 10:554610-554632 CAGGGCAGTGGGGAGGAGAAGGG - Intronic
1064173094 10:13051226-13051248 CAAATTAGTGGGGAGGAAGAGGG + Intronic
1067482696 10:46614055-46614077 GAGGTGAGGGGTGAGCAGGATGG - Intergenic
1067612055 10:47727609-47727631 GAGGTGAGGGGTGAGCAGGATGG + Intergenic
1068111652 10:52687324-52687346 CAGTTTAGGGGTTAGAAGGAAGG - Intergenic
1068965138 10:62904299-62904321 GAGGTTTGAGGTGAGGAAGAAGG - Intronic
1070555644 10:77525776-77525798 CATGTTAGTAACGAGGAGGAGGG - Intronic
1070557356 10:77538962-77538984 CAGGTTACTGCTCAGCAGGAGGG - Intronic
1070970031 10:80555874-80555896 CATATTAGTGCAGAGGAGGAAGG + Intronic
1071627478 10:87187851-87187873 GAGGTGAGGGGTGAGCAGGATGG + Intronic
1072220536 10:93324025-93324047 CAGGTAAGTGGCTAGCAGGAAGG + Intronic
1072236673 10:93459878-93459900 CAGGGTAGTGGTAAGGTAGAGGG - Intronic
1072993307 10:100219444-100219466 CAGGGTAGTGGTGAGGACCTTGG + Intronic
1073001440 10:100288959-100288981 CAGGAGAGTGGTGAGGAAGGGGG - Exonic
1073040608 10:100601952-100601974 CTGGTTAGTGGTGGCCAGGATGG - Intergenic
1073101420 10:101008643-101008665 CAGGCAAGTGGTCAGCAGGAAGG + Intronic
1074054492 10:109910119-109910141 CGGGTTAGAGGAGAGGAGGAAGG - Intronic
1074424382 10:113338228-113338250 CTGGGTAGGGGTGGGGAGGAGGG + Intergenic
1074848307 10:117418373-117418395 GAAGTAAGTGGAGAGGAGGAAGG - Intergenic
1076299185 10:129411852-129411874 GAGCTTAGGGTTGAGGAGGATGG + Intergenic
1076365400 10:129918550-129918572 CAGGTTGGTGGTGCGGAGGAGGG - Intronic
1077881209 11:6351976-6351998 CAGGTCAGTGGGTAGGAGGGAGG + Intergenic
1078857083 11:15215149-15215171 CATGCAAGTGGTGATGAGGATGG - Intronic
1079994002 11:27276024-27276046 GAGGCTAGTTGTGAGCAGGATGG + Intergenic
1080133537 11:28825716-28825738 CAGGTTGGCAGTGAAGAGGAAGG - Intergenic
1080255575 11:30287253-30287275 GAGGTAAGTGGTGAGGATGCAGG - Intergenic
1080293421 11:30697758-30697780 CAGGTTAGCAGGGATGAGGAGGG + Intergenic
1080779657 11:35418982-35419004 CCGGATAGTGCTGAAGAGGAGGG - Exonic
1081402464 11:42658959-42658981 AAGGTTGGTGCTGAGGAGCAAGG + Intergenic
1081917468 11:46741941-46741963 CAGGATAGTGGAGTGGAGCAGGG + Intergenic
1082818029 11:57523379-57523401 GAGGATAGTGGTGAGGAAGGTGG - Intergenic
1082832516 11:57629434-57629456 CAGGTTTGTGGGGATGGGGAAGG + Intergenic
1082890325 11:58132303-58132325 CAGGATAGTGGTTAAGAGTAAGG + Intronic
1083167314 11:60898617-60898639 CAGGTGAGAGCTGTGGAGGAGGG + Exonic
1083170907 11:60923739-60923761 CAGGTGGGTGGTGAAGGGGAGGG - Intergenic
1084130709 11:67132071-67132093 CAGGTAGGTAGAGAGGAGGAGGG + Intronic
1085114121 11:73915120-73915142 CAGTTTAGTGATGAGGAAGCAGG - Intronic
1085263902 11:75224987-75225009 CTGGGTGGTGGTGAGGAGGTGGG - Intergenic
1086582381 11:88414163-88414185 CAGGGTGGTGGTGGGGAGGATGG - Intergenic
1087861486 11:103163341-103163363 TAGGCCAGTGGTGAGTAGGATGG + Intronic
1088466894 11:110149262-110149284 CAGGTTAGTGGGGATGAGCAGGG - Intronic
1089526609 11:119101250-119101272 CTGGTAAGTGGTGAGGGGGGCGG + Intronic
1089624914 11:119745237-119745259 GAGGTTGGTGGTGAGAAGGGCGG + Intergenic
1091037274 11:132245392-132245414 CAGGACAGAGGTGAGGAGGGAGG + Intronic
1091250746 11:134141779-134141801 CAGGTGGCTGGAGAGGAGGATGG + Intronic
1091253398 11:134163071-134163093 GAGGTTAGAGGTGAGGATGGAGG + Intronic
1091816817 12:3444973-3444995 AAGGTTAGGGGTGATGGGGAAGG + Intronic
1092112791 12:5975871-5975893 AAGGCTAGGGGTGAGGAAGAGGG - Intronic
1092931927 12:13324077-13324099 CAGGGTATTTATGAGGAGGAGGG - Intergenic
1093277174 12:17143718-17143740 CATTTTAGTGGTGAGGATGGTGG + Intergenic
1094700821 12:32869102-32869124 CAGGTTGGTAGGCAGGAGGAGGG - Intronic
1096089504 12:48889552-48889574 GAGGTGAGGGGAGAGGAGGAGGG - Intergenic
1096109884 12:49022260-49022282 CAGGTGAGAGATGACGAGGAAGG - Exonic
1097220853 12:57450208-57450230 GAGGGTAGTGGTCAGGAAGATGG - Exonic
1098343328 12:69473785-69473807 TAGGTGGGTGGCGAGGAGGAGGG + Intronic
1099118898 12:78663472-78663494 CAGGTAAGATGTGAGGAAGATGG - Intergenic
1099241026 12:80139131-80139153 CAGATTGCTGGTGAGGAGGATGG + Intergenic
1100847177 12:98671991-98672013 TAGTATAGTGGTGAGGAGCATGG + Intronic
1100974550 12:100108913-100108935 AAGGGTAGTGGTGGGGAGCAGGG + Intronic
1101539937 12:105655590-105655612 AAAGGTAGTGGTGAGGATGAGGG + Intergenic
1101758932 12:107643473-107643495 CAGGAGAGTAGTGAGGAGGCTGG + Intronic
1101979517 12:109393507-109393529 CAGATGCGTGGTGAGAAGGAAGG - Intronic
1102353929 12:112216438-112216460 CAGGGAAGTGGTGAAGTGGAGGG + Intronic
1102416229 12:112765201-112765223 CATGGGAGTGGTGGGGAGGAAGG + Intronic
1103192958 12:119017961-119017983 CACGTTAGTGATGAGGAAGTTGG - Intronic
1103277588 12:119725686-119725708 TAGGTTAGAAGTGAGAAGGAGGG + Intronic
1103302329 12:119937629-119937651 TAGGAAAGTGTTGAGGAGGAGGG + Intergenic
1106037489 13:26057311-26057333 GATGTTAGTGGAGAGGAGAAAGG - Intergenic
1106404556 13:29462509-29462531 CAGGGTGGTGGTGGTGAGGAGGG + Intronic
1106599408 13:31174978-31175000 CAAGCTACTGGTGAGGATGATGG + Intergenic
1106658156 13:31769414-31769436 GAGATTAGTGGTGTGGTGGAGGG - Intronic
1107396490 13:40023321-40023343 CAGTTTAGTGGTTAAGAGCATGG + Intergenic
1107507497 13:41049108-41049130 GTGGTAAGTGGTGAGGAGGTGGG - Intronic
1107601244 13:42014888-42014910 CATGTTATTGGGGTGGAGGACGG + Intergenic
1108102829 13:46975639-46975661 CCTGTTAGAGGTGCGGAGGATGG + Intergenic
1109789500 13:67228889-67228911 TAGGTTAGAGGCTAGGAGGAGGG - Intronic
1110796479 13:79644385-79644407 CAGGGTAGTAGTGAGGCTGAAGG - Intergenic
1110947437 13:81440439-81440461 AAGGGTAGTGGGGAGGAGGGGGG + Intergenic
1111796930 13:92933429-92933451 CAGGTTGGTTGTGATGAAGATGG - Intergenic
1112334727 13:98504854-98504876 CAGGTTCGGGCTGATGAGGAAGG + Intronic
1112543097 13:100336589-100336611 AGAGTTAGTTGTGAGGAGGAAGG + Intronic
1112576191 13:100638810-100638832 CAGGGCCGTGGTGTGGAGGACGG + Intronic
1113317004 13:109191477-109191499 CTGGAGAGTGGTGAGGAAGAAGG + Intronic
1113390267 13:109889776-109889798 CAGGGTAGAGGGTAGGAGGAGGG + Intergenic
1113881478 13:113629100-113629122 CAGGTGATGGGTGAGGAGCAGGG + Intronic
1115399513 14:32940358-32940380 CACGTTGGTGGTGATGGGGAGGG - Intronic
1117160187 14:52981854-52981876 AAGGTTAGTGGGGAGGAGCTGGG - Intergenic
1117570735 14:57046295-57046317 CTGCTTGGTGGTGAGGAGGATGG - Intergenic
1117729627 14:58709317-58709339 CAGATAAGTGGTGAGGAGCTGGG - Intergenic
1117772756 14:59151335-59151357 CAGGGTAGTGGCGATGGGGAAGG + Intergenic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119500812 14:75126273-75126295 CAAGGTCGGGGTGAGGAGGAGGG - Intronic
1119996657 14:79261105-79261127 CTGGGAAGGGGTGAGGAGGAGGG + Intronic
1121219979 14:92277933-92277955 CAGATGAGAGGTGAGGAGGCTGG + Intergenic
1121358444 14:93233801-93233823 TAGCTTAGTGGTGGAGAGGAGGG - Intergenic
1124679119 15:31714385-31714407 CAGGTGAGAGGTCAGGAGAATGG + Intronic
1125526322 15:40377648-40377670 CAGGGTACTGGAGAGGAGAAAGG + Intergenic
1126197848 15:45951642-45951664 CAGGGTAGAGGTGAGGGGTAGGG + Intergenic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126447708 15:48767533-48767555 GAGGGAAGAGGTGAGGAGGAAGG - Intronic
1127136531 15:55929477-55929499 GAGGGTAGAGGAGAGGAGGAGGG - Intronic
1128658360 15:69479072-69479094 GAGGTCAGTGGGGAGGAGGAGGG + Intergenic
1128744417 15:70103509-70103531 CAGGTGCGGGGTGAGGGGGAAGG - Intergenic
1129299593 15:74617957-74617979 CAAGTTAGTGGGGAGATGGAGGG + Intronic
1129601755 15:77003192-77003214 CAGGCTCTGGGTGAGGAGGAAGG - Intronic
1129922676 15:79333360-79333382 CAGTTTGGTGGTGAGCAGGGAGG - Intronic
1130098951 15:80877438-80877460 CGGGTTGGGGGTGAGGAGGTGGG - Intronic
1130381913 15:83378966-83378988 CGGGGTGGGGGTGAGGAGGAGGG + Intergenic
1130442739 15:83971664-83971686 CAGAGTGGTGGTGAGGAGGTTGG + Intronic
1130768515 15:86899382-86899404 GAGGGTAGAGGTGGGGAGGAGGG + Intronic
1130821963 15:87505316-87505338 CAAGTTTGTGGTGAGGATAAAGG - Intergenic
1132116297 15:99138687-99138709 CAGGACATGGGTGAGGAGGATGG + Intronic
1133367656 16:5223724-5223746 CAGGATTCTGATGAGGAGGAAGG + Intergenic
1134170366 16:11963603-11963625 GAGGTAAGTGGTGGGGAAGAAGG - Intronic
1134283729 16:12841592-12841614 GAGGTTAGTGGAGAGGAGATAGG + Intergenic
1135174398 16:20215257-20215279 CAGGGTAGTTCTGGGGAGGAGGG + Intergenic
1135532428 16:23265975-23265997 CAGCTTAGTCGTGAGGATCAGGG + Intergenic
1135538811 16:23314601-23314623 GAGGTGAGTGTGGAGGAGGAGGG + Intronic
1135621214 16:23957643-23957665 AAGGTGAGGGGTGGGGAGGAGGG - Intronic
1135983815 16:27169025-27169047 CAGGATTGTAGTGAGAAGGATGG + Intergenic
1136048803 16:27636218-27636240 CTGCCTAGTGGGGAGGAGGATGG - Intronic
1136610814 16:31363877-31363899 CGGGTTAGAGGTCAGGAGGCCGG - Intronic
1136909144 16:34132581-34132603 CAGGTTGAGGGTGGGGAGGAGGG + Intergenic
1137031492 16:35528310-35528332 CATGGCAGTGGTGAGAAGGATGG + Intergenic
1137072036 16:35912131-35912153 CAGGTCATGGGTGAGCAGGAGGG - Intergenic
1137638796 16:50010400-50010422 CATGTAAGGAGTGAGGAGGAGGG + Intergenic
1137793372 16:51194220-51194242 CAGGATAGTGGTGAAGAGTGGGG - Intergenic
1137902105 16:52279883-52279905 CAGTGTAGTGGGGAGGAGCAGGG + Intergenic
1138206172 16:55126780-55126802 GAGGATGGTGGGGAGGAGGAAGG - Intergenic
1138519848 16:57564756-57564778 GAGGATAGTGGTGAGGTGGAGGG + Intronic
1139301116 16:65946187-65946209 CAGGTGAGGGATGAGGAGGAAGG - Intergenic
1140732729 16:77871236-77871258 AAGGTCAGTGGTGGGGTGGAGGG - Intronic
1141222178 16:82081347-82081369 GGAGTTAGTGGGGAGGAGGAAGG - Intronic
1141307696 16:82881759-82881781 CCTGACAGTGGTGAGGAGGAGGG + Intronic
1141862631 16:86728348-86728370 CAGGAGAGGGGTGAGAAGGAGGG + Intergenic
1142817165 17:2435662-2435684 TGGGGTAGTGGTGGGGAGGAAGG + Intronic
1143106770 17:4534104-4534126 CAGGTTAGTGGCTGGGAGGCTGG + Intronic
1143115890 17:4581771-4581793 CACGTAAGTGAGGAGGAGGAGGG + Intergenic
1143510621 17:7393581-7393603 CAGGTGAGTGGGAAGGAGGGAGG - Exonic
1144702403 17:17348127-17348149 AAGGTTAGTGGGGAGGTGGCTGG - Intergenic
1146688390 17:34856811-34856833 CAGGATGGGGGTGCGGAGGATGG + Intergenic
1147176579 17:38659532-38659554 AAGGTTAATGTAGAGGAGGAAGG + Intergenic
1147332838 17:39709044-39709066 CAGAGTAGAGGTGAGAAGGAAGG + Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148391166 17:47274245-47274267 CAGGTTATTGGTTAGGAAGAAGG - Intronic
1148741319 17:49894734-49894756 TAGGTCAGTGGGGAGGAGGAAGG + Intergenic
1148905838 17:50911631-50911653 TAAGGTAGGGGTGAGGAGGAGGG - Intergenic
1149511278 17:57243747-57243769 AAGGGTGGTGGAGAGGAGGAAGG + Intergenic
1149523483 17:57336143-57336165 CAGGGTGGTGGTGAGGACGGTGG + Intronic
1149856011 17:60083524-60083546 TTGGTTAAAGGTGAGGAGGAGGG - Intergenic
1150370147 17:64630522-64630544 CAGGTTAGGGGTAAGCAGTAAGG + Intronic
1151027721 17:70698683-70698705 CAGGTGAGTGATGATGATGACGG + Intergenic
1151182664 17:72340864-72340886 CAGTTTAGATGGGAGGAGGATGG + Intergenic
1151376591 17:73693208-73693230 CAGGAGAGAGGAGAGGAGGAGGG - Intergenic
1151944506 17:77312149-77312171 CAGGGCAGGGGTGGGGAGGATGG - Intronic
1152028177 17:77825150-77825172 CAGGTGAGTTATGGGGAGGAGGG - Intergenic
1152032354 17:77851779-77851801 CAGGACAGTGGGCAGGAGGATGG - Intergenic
1152556376 17:81055148-81055170 CAGGTTAGAGGTGTCAAGGACGG + Intronic
1152678398 17:81653297-81653319 CAGGTTCATGGTGAGGCTGACGG + Exonic
1153147049 18:2045190-2045212 CAAGGTAGAGGTGGGGAGGAGGG + Intergenic
1155173038 18:23281113-23281135 TAGGTCAGTGGAGGGGAGGAGGG + Intronic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155691180 18:28624950-28624972 CAGGTTAGAGATGGGCAGGAGGG + Intergenic
1155697688 18:28702160-28702182 CAGGTAAGTGGGTAGGTGGAGGG + Intergenic
1156106515 18:33669280-33669302 CAGGCTAAAGGTGAGAAGGATGG + Intronic
1156521362 18:37724688-37724710 CAGGGTCCTGGTGAGGAGCAGGG - Intergenic
1157712062 18:49857028-49857050 CAGGTGACAGGAGAGGAGGAAGG - Intronic
1158174816 18:54643192-54643214 GAGGTTGGAGGTTAGGAGGAGGG - Intergenic
1158663437 18:59410497-59410519 CATGTTAGTGGTGTGAAGTAAGG + Intergenic
1159281394 18:66290723-66290745 CTGATTAGTGGAGAGAAGGATGG - Intergenic
1160146463 18:76369629-76369651 CTGGTTGCTGGTGAGGATGAGGG - Intronic
1160395952 18:78572402-78572424 ATGGTTACAGGTGAGGAGGACGG + Intergenic
1160760684 19:782618-782640 GGGTTTAGTGGTGAGCAGGAGGG - Intergenic
1161536886 19:4824968-4824990 AAGGGTGGTGGTGAGGAGGAGGG + Intronic
1162180891 19:8867927-8867949 CAGGTGAATGGGCAGGAGGATGG + Intronic
1163273404 19:16267623-16267645 CAGGTTGGATGGGAGGAGGAGGG + Intergenic
1164150702 19:22548000-22548022 CAGGTGGGTGGGGATGAGGAGGG - Intergenic
1164696047 19:30245157-30245179 CAGGTAAAAGGTGAGGATGAGGG - Intronic
1165075878 19:33279687-33279709 CCGGTGTGTGGTGGGGAGGAAGG - Intergenic
1165445887 19:35856645-35856667 CAGGCAAGGGGTGAGGAGGAGGG - Intronic
1165799332 19:38537951-38537973 CACAATAATGGTGAGGAGGAGGG + Exonic
1166046382 19:40233190-40233212 CAGTTTGGTGGGGAGGAGGCCGG + Exonic
1166552482 19:43675597-43675619 CAGGTGAGTCACGAGGAGGAAGG - Intergenic
1167169105 19:47819515-47819537 GATGTAAGTGGTGAGGAGAAAGG + Intergenic
1167640605 19:50679155-50679177 CAGGTAAGGGGTGAGGGTGATGG + Intronic
1167867091 19:52337178-52337200 CAGAGTAGGGGAGAGGAGGAGGG + Intronic
1168136617 19:54356210-54356232 CAGGTAAAGGGGGAGGAGGAGGG - Exonic
1168166752 19:54553870-54553892 CAGGTAGGTGGTGAGGTGAATGG + Intergenic
1168246485 19:55115235-55115257 CAGGGCTGTGGTGAGGAGGGGGG - Intronic
924998682 2:386714-386736 CAGGTAAGTGGTGAGCAGTGGGG - Intergenic
926422673 2:12715522-12715544 CAGGTTTGTGGGGAGTAGGATGG + Intergenic
927263275 2:21116567-21116589 TTGGTTAGAAGTGAGGAGGAGGG + Intergenic
928273275 2:29876432-29876454 GATGGTAGTGGTGAGGATGATGG + Intronic
929235230 2:39598109-39598131 AAGATTTGTGATGAGGAGGAGGG - Intergenic
929886642 2:45884392-45884414 CAGGGTGGTGGTGAGGAAGGAGG + Intronic
931262225 2:60630392-60630414 CAGGTTAGGAGAGTGGAGGAGGG - Intergenic
932115455 2:69042732-69042754 CAGGTGAAGGGTGGGGAGGAGGG - Intronic
932130282 2:69181207-69181229 CAGGATAGTGGTGGTGGGGATGG + Intronic
932587444 2:73040400-73040422 CAGGTTAAGGGTGGGAAGGATGG - Intronic
935110591 2:100091068-100091090 CAGGATAGTGGTGATGTGTAGGG + Intronic
935278979 2:101501625-101501647 CAGGCTTGTGGTCAGGTGGATGG + Intergenic
936124381 2:109774094-109774116 CAGGATAGTGGTGATGTGTAGGG - Intergenic
936220308 2:110597370-110597392 CAGGATAGTGGTGATGTGTAGGG + Intergenic
936998566 2:118440358-118440380 GAGGTGAATGGTGAGAAGGACGG - Intergenic
939327517 2:140712783-140712805 CATGTAACTGGTGATGAGGATGG - Intronic
939430764 2:142104128-142104150 CACCTTAGTGGTGCGGAAGAGGG + Intronic
940258195 2:151754489-151754511 CAGATCAGAGGTGGGGAGGATGG - Intergenic
940317749 2:152342659-152342681 CAGGTTTCTGGAAAGGAGGAAGG - Intronic
943016080 2:182512095-182512117 TAGGGTAGTGGTGAGGTGGTGGG - Intronic
943343333 2:186707767-186707789 CAGGTGATTGGGGTGGAGGATGG - Intronic
944014472 2:195018118-195018140 TAGGTGAGTGGTGAGAAGGCAGG + Intergenic
944494821 2:200296044-200296066 CAGGTGAGTGGTCAGCAGGCAGG - Intergenic
944632046 2:201637027-201637049 AAAGTTACAGGTGAGGAGGAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945176738 2:207051086-207051108 TAGGTTGGTGGTGGGAAGGAGGG - Intergenic
945741091 2:213662155-213662177 AAGGTGAGGGGTGAGGGGGAGGG + Intronic
945939314 2:215932458-215932480 CAGCAAAGTGGTGAGGATGAAGG - Intergenic
947375305 2:229489516-229489538 AAGGAAGGTGGTGAGGAGGAGGG + Intronic
947827856 2:233118365-233118387 CGGGTGGGTGGTGAGGAGCATGG - Intronic
947867500 2:233409713-233409735 CAATTGTGTGGTGAGGAGGAAGG - Intronic
947928885 2:233946028-233946050 AAGGTCAGTGGTTAGGAGGTAGG + Exonic
948272803 2:236687183-236687205 CAGGATAGTGGTGATTGGGAAGG + Intergenic
948803576 2:240443535-240443557 CAGGGCTGTGGTGGGGAGGAGGG + Intronic
1169198338 20:3695085-3695107 CAGGAGAGTGGGGAGCAGGAGGG - Intronic
1171266626 20:23776473-23776495 GAGGAGAGTAGTGAGGAGGAGGG - Intergenic
1171276175 20:23858109-23858131 GAGGAGAGTAGTGAGGAGGAGGG - Intergenic
1171412614 20:24957085-24957107 CAGGTTAGGGGTGGGTAGGGTGG + Intronic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172144169 20:32744478-32744500 AAGGGTAGAGGAGAGGAGGAGGG - Intergenic
1172779854 20:37430087-37430109 TAGGTGGGTGGAGAGGAGGATGG - Intergenic
1173331623 20:42080299-42080321 CAGGTTAGGTGTGAGGATGGGGG + Exonic
1173571413 20:44079137-44079159 CAGGGGAGTGGGGAGTAGGAGGG + Intergenic
1174102852 20:48140288-48140310 GAGTTTAGTGGTGAGGTGGTGGG - Intergenic
1174185064 20:48700733-48700755 CAGGTGAGTGGCCAGGAGGCTGG - Exonic
1175625222 20:60484010-60484032 CAGGAGAGTGGGGAGGGGGAGGG - Intergenic
1175749530 20:61485588-61485610 CAGGGTACTGGTGGGGAGGGTGG + Intronic
1175992641 20:62797060-62797082 CCGGTGAGCGGTGAGGAGAAAGG - Intronic
1178201065 21:30405792-30405814 CAATCTAGTGGTGATGAGGATGG - Intronic
1178498177 21:33104342-33104364 CAGGGAAGTGGGGAGCAGGAAGG + Intergenic
1179308875 21:40179434-40179456 CAGGTTAGTGGAATGGACGATGG + Intronic
1179609557 21:42541054-42541076 CAGGGTTGGGGAGAGGAGGATGG + Intronic
1179902856 21:44402826-44402848 CAGGGCAGTGGTGAGGGGGTGGG + Intronic
1180317304 22:11285979-11286001 CAGGTTGAGGGTGGGGAGGAGGG - Intergenic
1181054105 22:20251894-20251916 AAGGATAGTGGTGATGATGATGG - Intronic
1181054236 22:20252599-20252621 AAGGATAGTGGTGATGAAGATGG - Intronic
1181103050 22:20554398-20554420 CAGCTTAGGGGTGCAGAGGAGGG - Intronic
1181473387 22:23154241-23154263 CAGGCAAGTGGAGAGGAGGGGGG - Intronic
1182917801 22:34051398-34051420 CAGGTCAGTGGGGAGGAGACAGG + Intergenic
1183336289 22:37248787-37248809 AAGGCCTGTGGTGAGGAGGAGGG - Intergenic
1183487583 22:38097701-38097723 CAGGAGAGAGGGGAGGAGGATGG + Intronic
1184243321 22:43222880-43222902 CAGGGAAGTGGCCAGGAGGAAGG + Intronic
1184613000 22:45617760-45617782 CAAGTTAGTAGAGAAGAGGATGG - Intergenic
1184751144 22:46487558-46487580 CAGGTGGGGGGTGAGGGGGAGGG + Intronic
1184751214 22:46487720-46487742 CAGGTGGGGGGTGAGGGGGAGGG + Intronic
1185371166 22:50461557-50461579 CCGGTACGTGGTGAGGAAGACGG + Exonic
1185414431 22:50702048-50702070 CAGGTAGGTGGAGAGGTGGATGG - Intergenic
950120987 3:10482507-10482529 CAGGCTGATGGTGAGGAGAAGGG + Intronic
950128759 3:10527640-10527662 CAGGGCAGTGGTGGGGAGGTAGG - Intronic
950185021 3:10939564-10939586 GAGGTTAGGGGACAGGAGGAGGG - Exonic
950369354 3:12515249-12515271 CGGGTTAGTGGTGGGGTGGAAGG + Intronic
950454072 3:13082379-13082401 CAGGTCAGGGCTGGGGAGGAAGG + Intergenic
950988772 3:17408029-17408051 CAGGATAGTGGTTAAGAGAATGG + Intronic
951026342 3:17834524-17834546 CAGGTTGGTGGTGATGGAGATGG + Intronic
952522771 3:34178798-34178820 TCATTTAGTGGTGAGGAGGATGG + Intergenic
952967414 3:38629905-38629927 CAAGTGGGTGGGGAGGAGGACGG + Intronic
953006540 3:38984416-38984438 CACCTTAGTGGTGAGGACAAGGG + Intergenic
954266261 3:49472417-49472439 CTGGTTAGTGTTGAGGATGGTGG + Intronic
954363550 3:50134710-50134732 CAGGCTAGGGCTGGGGAGGAGGG + Intergenic
954602262 3:51878749-51878771 CAGATCAGAGGTGAGGAGGCTGG + Intergenic
954675510 3:52313315-52313337 CAGGATGGTGGAGTGGAGGAGGG + Intergenic
955537751 3:59942330-59942352 CAGGAGTGTGGGGAGGAGGAAGG - Intronic
955800050 3:62677256-62677278 GGTGCTAGTGGTGAGGAGGAAGG - Intronic
956138256 3:66120067-66120089 CAAGTTAGGGGTGGGGTGGAAGG + Intergenic
957355700 3:79082852-79082874 CAGGTTGATGGTGTGGAGGGAGG + Intronic
958827324 3:99046974-99046996 CAGGTTAGTGGGTGGGAGGAAGG + Intergenic
959067471 3:101673152-101673174 TAGGGTAGGGGTGAGGAGGCAGG + Intronic
960465243 3:117989953-117989975 GTGGTTTGTGATGAGGAGGAAGG - Intergenic
962203190 3:133416332-133416354 CAGGACAGGGGTGAGGAGAAGGG - Intronic
962775294 3:138653514-138653536 CAGGTCAGTGGTTTGGAGAATGG - Exonic
963650724 3:147976700-147976722 GAGGTTAGTGTGGAGGAGGATGG + Intergenic
964336277 3:155658054-155658076 CCGGTTGGTGGTGACAAGGATGG + Intronic
964893711 3:161568501-161568523 CAGCTTAGTGCTGAGTAGTATGG + Intergenic
966384714 3:179383993-179384015 CAGATTAGTGGTGAGGCTGGAGG - Intronic
969445287 4:7241339-7241361 CTGGTTAGTGCTGTGGAGAAGGG + Intronic
969500998 4:7552879-7552901 AAGTATAGTGGTGAGGAGAATGG + Intronic
969637670 4:8378625-8378647 CAGGCTAGAGGTAGGGAGGAGGG + Intronic
971826580 4:31631063-31631085 CAGCTGAGTGGTGGGAAGGAAGG + Intergenic
973774948 4:54233728-54233750 CAGGGGAGTGTGGAGGAGGACGG + Intronic
974072032 4:57132611-57132633 CAGGTTATTGGAGAGGAAGTTGG + Intergenic
975613005 4:76219782-76219804 CAGGTTAGTGGTGAGGGGCGGGG - Intronic
976698131 4:87939803-87939825 CATTTTAGTGGTGAGCAGGATGG + Intergenic
977401712 4:96541104-96541126 GAGGTTAGTGGTGAGGAAGGGGG - Intergenic
979640909 4:123012086-123012108 CAGGAAAGTGGAGAGAAGGAAGG + Intronic
979640985 4:123012341-123012363 CAGGAAAGTGGAGAGAAGGAAGG + Intronic
979916976 4:126447370-126447392 CATGTGAGTAGAGAGGAGGAAGG + Intergenic
980191207 4:129527558-129527580 CAGGTAAGAGGTGAAGAGGTTGG + Intergenic
980506429 4:133730134-133730156 AAGGTAACTGCTGAGGAGGATGG - Intergenic
981509572 4:145541109-145541131 CAGGTTAGTGGTGAGGAGGAAGG - Intronic
981728767 4:147875499-147875521 GAGGGTAGAGGTGAGGGGGAAGG - Intronic
981769485 4:148291196-148291218 CAGGTTTGTAATTAGGAGGAGGG - Intronic
982907786 4:161098759-161098781 CAGGTTTGGGGTGAGAAAGAAGG - Intergenic
984957543 4:185060401-185060423 AAAGGGAGTGGTGAGGAGGAGGG - Intergenic
985117258 4:186604726-186604748 GAGTGTGGTGGTGAGGAGGAGGG + Intronic
985271267 4:188197005-188197027 CAGGTGGGTGGGGAGGGGGAAGG - Intergenic
985271426 4:188197605-188197627 CAGGTGGGTGGGGAGGGGGAAGG - Intergenic
985882949 5:2654347-2654369 TAGGTGAGGGGTGAGGGGGATGG + Intergenic
988529101 5:32011651-32011673 CAGGAGAGTGGGAAGGAGGAAGG - Intronic
991203822 5:64025833-64025855 GAGGTCAGTGGGGAGGAGAAAGG + Intergenic
992225063 5:74612254-74612276 CAGGCTAGTGCTGAGGAGGTGGG - Intergenic
992486269 5:77199712-77199734 CAGGTTAGTGGTAAACAGAAAGG + Intergenic
992491029 5:77244824-77244846 TAGCTTAGTGGTCAAGAGGATGG - Intronic
993367438 5:87050693-87050715 CAGGCTAGGGGAGAGGAGGCAGG + Intergenic
994700350 5:103125430-103125452 CAGGCTAGTGGTTAAGAGCATGG - Intronic
996339349 5:122418955-122418977 CAGTTTAGTGATGATGAAGAGGG + Intronic
996541232 5:124631508-124631530 CTGGAGAGTGGTGAGGAAGATGG + Intergenic
996661106 5:126003756-126003778 CAGGTTTTGGGGGAGGAGGAGGG - Intergenic
997291052 5:132735934-132735956 AAGGCCAGTGGTGAGGAGCATGG - Intronic
997610613 5:135213197-135213219 TAGGTTGTTGCTGAGGAGGAAGG + Intronic
997694392 5:135850011-135850033 CATGTTTCTGGTGAGGATGAGGG + Intronic
997904386 5:137800843-137800865 GAGGGTAGTGGGTAGGAGGAGGG - Intergenic
997962870 5:138335914-138335936 CAGCTTAGTGGTGAAAAGCAAGG + Intronic
997977727 5:138449997-138450019 CAGGTCCGTCGGGAGGAGGAGGG + Intergenic
998376105 5:141692021-141692043 CAGCTTAGTGGTGAAGAGCTTGG - Intergenic
998417316 5:141955386-141955408 CAGGGTCGGGGTGAGGTGGAAGG + Exonic
999759576 5:154690147-154690169 TAGGTTAGTGGTGCGGGGGAGGG + Intergenic
999871973 5:155761796-155761818 AAGGTTGATGGTGAGGATGATGG - Intergenic
1000173358 5:158726233-158726255 CTGGTTAGTAGTAAGGAGAATGG - Intronic
1001032607 5:168273632-168273654 CAGGTTGGTGGTGCGGGGGTGGG + Intergenic
1001631360 5:173177851-173177873 CAGGCAAGCGGAGAGGAGGAGGG + Intergenic
1001758987 5:174192256-174192278 CAGGTGAGGGTTGTGGAGGAGGG - Intronic
1002292368 5:178208768-178208790 CAGACCAGTGGTTAGGAGGAGGG + Exonic
1002452330 5:179325985-179326007 CAGCTGAGGGGTGCGGAGGAAGG + Intronic
1002529898 5:179838060-179838082 AAGGTTTGCGGTGAGGTGGAAGG - Exonic
1006094457 6:31647262-31647284 CAGGATTGTGGTGGGGAGGGTGG - Intronic
1006183128 6:32165888-32165910 TAGGTTAGAGGGGAGGTGGAGGG + Intronic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007287109 6:40755567-40755589 CAGGTGAAGGGGGAGGAGGAGGG - Intergenic
1007712982 6:43836360-43836382 CTGGAGAGTGGGGAGGAGGAAGG + Intergenic
1007729515 6:43937422-43937444 CATGTGTGTGGTGAGGAGGTGGG - Intergenic
1007840444 6:44711889-44711911 CACCTTAGTGGTGAAGAGCATGG - Intergenic
1008955002 6:57205901-57205923 CAGCAGAGTGGAGAGGAGGAAGG + Intronic
1011377792 6:86708395-86708417 GAGGCTGGTGGTGAGGAGGGGGG - Intergenic
1011607280 6:89117783-89117805 CAGGTTGGGGGCGCGGAGGAGGG - Intronic
1011792463 6:90913425-90913447 CAGGGGGATGGTGAGGAGGAGGG - Intergenic
1012688799 6:102287696-102287718 GAGGTAGGTGGTGAAGAGGAAGG + Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1014905645 6:127023860-127023882 GAGGTTGGAGGTGGGGAGGAGGG - Intergenic
1015118945 6:129680469-129680491 GAGGTTATTATTGAGGAGGAAGG - Intronic
1015434693 6:133172477-133172499 CAGGCTGTTGGTGTGGAGGAGGG - Intergenic
1015579047 6:134703522-134703544 AAGGTGAGTGGTGGGAAGGAGGG + Intergenic
1017026414 6:150185239-150185261 CAGGGTAGTTGTGAGGATGAAGG + Intronic
1017862143 6:158408692-158408714 GAGGTCAGTGGTGAGGAAGGCGG - Intronic
1018676058 6:166223265-166223287 CAGATAAGTGGGGAGGAGCAGGG + Intergenic
1018872983 6:167797065-167797087 CAGGTGAGAGGAGAGGAGGGAGG + Intergenic
1019075863 6:169387742-169387764 CAGGTAGGTGGTGAGGGGAAGGG - Intergenic
1019278631 7:188905-188927 CAGCTGTGTGGTGAGGACGAAGG - Intergenic
1020004669 7:4775914-4775936 CAGGCTTGGGGTGAGGAGGTCGG + Intronic
1021934195 7:25614162-25614184 CAGGCAGGTGCTGAGGAGGAAGG + Intergenic
1022227998 7:28383197-28383219 CATGTTAATGGTGAGAAAGATGG + Intronic
1022312710 7:29212281-29212303 CATGTTAGTATTGAGGAAGAGGG - Intronic
1022594398 7:31698387-31698409 CAGGTAAGTGGTGAAGACGAAGG - Intronic
1023365455 7:39458935-39458957 CAGGAGAGTGGAGAGGAGGGAGG - Intronic
1023372926 7:39530073-39530095 AAGGAGAGTAGTGAGGAGGACGG + Intergenic
1023990180 7:45124096-45124118 CAGGGGGGTGGTGGGGAGGAGGG + Intergenic
1028940718 7:96519527-96519549 TAGGTTGGTGATGAGGAAGAGGG + Intronic
1030642527 7:112022466-112022488 CAGAGTAGCGGTGAGGAGCATGG + Intronic
1031930943 7:127685383-127685405 AAGGTTAGTAGTGAGAAGGTTGG - Intronic
1034137672 7:148786425-148786447 CAGATTAGTGCAGAGGAAGAGGG - Intronic
1034387126 7:150749146-150749168 CAGGTTAGGGGTGGGGAGTAGGG + Intronic
1034820718 7:154213930-154213952 CATGTTACTGGTGAGCAGGGAGG - Intronic
1035820102 8:2581713-2581735 CAGGAGAGTGGTGGAGAGGAGGG + Intergenic
1036058691 8:5290209-5290231 GACGTTAGTGGTGAAGATGAGGG + Intergenic
1036991694 8:13605404-13605426 CAGGGCAGTGGTGAAAAGGACGG - Intergenic
1037716813 8:21407907-21407929 CAGCAGAGTGGGGAGGAGGAAGG - Intergenic
1039458452 8:37724107-37724129 AGGGAAAGTGGTGAGGAGGAAGG - Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1041707281 8:60859929-60859951 CAGCGTAGTGGTGTGGAGGTTGG + Intronic
1043586449 8:81775487-81775509 AAGGATAGAGGGGAGGAGGAGGG - Intergenic
1043923385 8:86009618-86009640 CAGGGTAGAGGGTAGGAGGAGGG - Intronic
1044908680 8:97032981-97033003 CATGTTAGTCGTGAGGAAGGAGG + Intronic
1045701516 8:104871829-104871851 TAGGTTAGAGGTAAGGAAGATGG + Intronic
1047538030 8:125737067-125737089 CAGGTGGGTGGTGAGGAAGGTGG + Intergenic
1047762097 8:127961942-127961964 CAGGTTTGTTGTGAGGACGAAGG + Intergenic
1047844916 8:128794998-128795020 GAGGTGGGTGGTGAGGGGGATGG + Intergenic
1047894607 8:129352784-129352806 AAGGTTAGTGGTGAAAATGAAGG - Intergenic
1048256138 8:132906568-132906590 CAGGGAAGGGGAGAGGAGGAGGG + Intronic
1048618344 8:136104132-136104154 TAGGGTAGGGGTGAGGAGAAGGG - Intergenic
1049077055 8:140406652-140406674 CAGGTAAGTGGAGAGATGGATGG + Intronic
1049243495 8:141550281-141550303 CAGGTGAGCAGGGAGGAGGATGG + Intergenic
1049296073 8:141839848-141839870 CAGTTTAGTGGTGATGATGTTGG + Intergenic
1049442273 8:142614842-142614864 GAGGCGAGTGGAGAGGAGGAAGG - Intergenic
1051871765 9:21746134-21746156 TAGATTAGTGCTGGGGAGGATGG - Intergenic
1052854344 9:33397843-33397865 CAGCTGTGTGGTGATGAGGAAGG - Intronic
1053150403 9:35739537-35739559 CAGGGTATTGGTTAGGATGAGGG - Intronic
1054928175 9:70609246-70609268 CAGCTTAGTGGTGACAAGCATGG - Intronic
1055780908 9:79820592-79820614 CAGGTGTTTGGTGAAGAGGAGGG - Intergenic
1055887788 9:81085354-81085376 CAGGTTAGGTGTGAAGAGAAAGG - Intergenic
1056559870 9:87720859-87720881 CTGGTGAGTGGTGAGCATGATGG - Intergenic
1057894894 9:98901206-98901228 CAGATTAGAGGGGAGAAGGAAGG + Intergenic
1058750328 9:108033003-108033025 CAGGTGAGTTTTGATGAGGATGG - Intergenic
1059331136 9:113536554-113536576 CAGGTTGGGGGAGGGGAGGAAGG - Intronic
1059575326 9:115481958-115481980 CAGGATTGTGGTAAGGAAGATGG + Intergenic
1060196105 9:121624305-121624327 GAGGTTCGTGGCAAGGAGGAAGG + Intronic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1060732495 9:126047586-126047608 CAGGTGAGGGGTGGGGAAGAGGG - Intergenic
1060952578 9:127613044-127613066 CAGGAGGGTGGGGAGGAGGAGGG - Intronic
1187504434 X:19867302-19867324 CAAGTTAGGGGTGGGGAGGGAGG + Intronic
1188024926 X:25198162-25198184 CAGGGTAGTGTGGAGGAGTAGGG + Intergenic
1192139245 X:68633546-68633568 GAGCTTAGTAGTGAGGAGAAAGG + Intergenic
1192206658 X:69100947-69100969 CAAGTGAGGGGTGGGGAGGATGG - Intergenic
1192586625 X:72324221-72324243 CAAGTAAGTGGTTAGGAGAAAGG + Intergenic
1192615862 X:72621400-72621422 CATTTCAGTGGTGAAGAGGATGG + Intronic
1192875410 X:75224458-75224480 AATGTGAGTGGTAAGGAGGAGGG - Intergenic
1194461772 X:94178478-94178500 CATGTTAGTCGACAGGAGGAAGG + Intergenic
1194540518 X:95164671-95164693 TAGGTTAGTTGTCAGCAGGAGGG + Intergenic
1195070949 X:101278868-101278890 AGGGTTAGAGGTGAGAAGGAAGG + Intronic
1195169659 X:102253922-102253944 CAGGGTCGGGGTGGGGAGGAGGG - Intergenic
1195189198 X:102433177-102433199 CAGGGTCGGGGTGGGGAGGAGGG + Intronic
1195320613 X:103718969-103718991 AAGGTAAATGGTGAGCAGGAGGG + Intronic
1195610822 X:106864166-106864188 CAGTTTAGAGGTGAGGTGGGAGG + Intronic
1195614304 X:106900654-106900676 TAGGTTAGGGGTGAGGAAGGGGG + Exonic
1195958133 X:110356066-110356088 GAGGTTAGTGGGGAGGAGGAGGG + Intronic
1197273234 X:124448864-124448886 GAGGTGAGGTGTGAGGAGGATGG + Intronic
1200831850 Y:7693181-7693203 CAGGGCAGTGGGGATGAGGATGG - Intergenic
1201501305 Y:14645822-14645844 GAGGATGGTGATGAGGAGGATGG + Intronic