ID: 981509572

View in Genome Browser
Species Human (GRCh38)
Location 4:145541109-145541131
Sequence CAGGTTAGTGGTGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509572_981509581 2 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG No data
Right 981509581 4:145541134-145541156 TGATGGGCAGGTTAGTGGTGAGG 0: 1
1: 0
2: 0
3: 27
4: 271
981509572_981509580 -3 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG No data
Right 981509580 4:145541129-145541151 CTGTATGATGGGCAGGTTAGTGG 0: 1
1: 0
2: 0
3: 8
4: 148
981509572_981509578 -10 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG No data
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509572 Original CRISPR CAGGTTAGTGGTGAGGAGGA AGG (reversed) Intronic