ID: 981509578

View in Genome Browser
Species Human (GRCh38)
Location 4:145541122-145541144
Sequence CACTAACCTGTATGATGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981509569_981509578 6 Left 981509569 4:145541093-145541115 CCTGTCTACCTCTCTCCCTTCCT 0: 1
1: 0
2: 51
3: 913
4: 7883
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509572_981509578 -10 Left 981509572 4:145541109-145541131 CCTTCCTCCTCACCACTAACCTG 0: 1
1: 0
2: 2
3: 29
4: 448
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509571_981509578 -9 Left 981509571 4:145541108-145541130 CCCTTCCTCCTCACCACTAACCT 0: 1
1: 0
2: 0
3: 53
4: 504
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data
981509570_981509578 -2 Left 981509570 4:145541101-145541123 CCTCTCTCCCTTCCTCCTCACCA 0: 1
1: 4
2: 24
3: 338
4: 2666
Right 981509578 4:145541122-145541144 CACTAACCTGTATGATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981509578 Original CRISPR CACTAACCTGTATGATGGGC AGG Intronic
No off target data available for this crispr