ID: 981510917

View in Genome Browser
Species Human (GRCh38)
Location 4:145557533-145557555
Sequence TTGCTGGTCTTGAGGAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981510917_981510924 8 Left 981510917 4:145557533-145557555 CCTTCATTCCTCAAGACCAGCAA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 981510924 4:145557564-145557586 GGAATCCATGGATGGACCCTGGG No data
981510917_981510925 9 Left 981510917 4:145557533-145557555 CCTTCATTCCTCAAGACCAGCAA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 981510925 4:145557565-145557587 GAATCCATGGATGGACCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 213
981510917_981510922 0 Left 981510917 4:145557533-145557555 CCTTCATTCCTCAAGACCAGCAA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 981510922 4:145557556-145557578 TTCTTATTGGAATCCATGGATGG 0: 1
1: 0
2: 0
3: 19
4: 194
981510917_981510923 7 Left 981510917 4:145557533-145557555 CCTTCATTCCTCAAGACCAGCAA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 981510923 4:145557563-145557585 TGGAATCCATGGATGGACCCTGG 0: 1
1: 0
2: 0
3: 9
4: 174
981510917_981510921 -4 Left 981510917 4:145557533-145557555 CCTTCATTCCTCAAGACCAGCAA 0: 1
1: 0
2: 2
3: 28
4: 238
Right 981510921 4:145557552-145557574 GCAATTCTTATTGGAATCCATGG 0: 1
1: 0
2: 0
3: 7
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981510917 Original CRISPR TTGCTGGTCTTGAGGAATGA AGG (reversed) Intronic
902534212 1:17109921-17109943 TCTCTGGTCCAGAGGAATGAAGG - Intronic
903387158 1:22934804-22934826 TTGCTGGTTTTGAAGGAAGAAGG - Intergenic
904040558 1:27582037-27582059 CTGCTGGTCTGGCGGAATCAGGG - Intronic
906078935 1:43071022-43071044 ATGTTTGTCTTGAGGAATAAAGG + Intergenic
907321058 1:53602608-53602630 TTGAAGGTCTTGATGAGTGAGGG - Intronic
907748657 1:57240715-57240737 AGGCTGGGCTTGAGAAATGAAGG + Intronic
909038443 1:70622242-70622264 TTTTAGGTCTTGAGGAATGGTGG + Intergenic
910168469 1:84353067-84353089 TTGCTGGTTTTAAGAAATTAGGG - Intronic
911783776 1:101918482-101918504 TTGCTGGTTTTGAAGATGGAAGG - Intronic
912956722 1:114159124-114159146 TTACTGGTCTAGAGGAAAGATGG + Intergenic
914077384 1:144367552-144367574 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914101795 1:144598953-144598975 TAGCTGGTTTTAAGGAATGAAGG + Intergenic
914172290 1:145236093-145236115 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914297166 1:146338559-146338581 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914526939 1:148477096-148477118 TAGCTGGTTTTAAGGAATGAAGG - Intergenic
914639463 1:149590038-149590060 TAGCTGGTTTTAAGGAATGAAGG + Intergenic
914931573 1:151938915-151938937 TTGCTGGTTTTGAAGATGGAAGG - Intergenic
915715389 1:157940290-157940312 TTGCTGGTTGAGATGAATGAAGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918221855 1:182442643-182442665 TTGCTGGAATTGAGGAGAGAGGG - Intergenic
920435144 1:205942555-205942577 GGGCTGGTTTTGAGGAATGGGGG + Intronic
922409396 1:225356279-225356301 TTGCTGCCATTGAGGAATGTGGG - Intronic
923768353 1:236913918-236913940 TTGCTGGACTTGATAACTGAGGG - Intergenic
1063560340 10:7120456-7120478 ATGCTGGCCATGAGGAAAGATGG + Intergenic
1064199702 10:13274108-13274130 TTGCTGGACTTGGGGAGGGAGGG + Intergenic
1066057204 10:31693340-31693362 TTGCTCCTCTGGAGGAATAAAGG + Intergenic
1071137479 10:82468802-82468824 TTGGTGGTCATGGGGAAGGATGG + Intronic
1072031956 10:91529811-91529833 TGGCTGGCTTTGAGGAAGGATGG + Intergenic
1072066179 10:91873608-91873630 TTGCTGGTCAAAGGGAATGAAGG - Intergenic
1073057434 10:100711370-100711392 TTCTTGGTCTTGAGATATGAGGG + Intergenic
1074604471 10:114947110-114947132 TTGCTGGCTTTGAAGAGTGAAGG + Intronic
1074710906 10:116176744-116176766 TTGCTGGTTGTGAGGAAGGAAGG - Intronic
1074715873 10:116218231-116218253 ATGGTGGTCTTGAGAAACGAAGG - Intronic
1077087332 11:760446-760468 TTGCTGGTGATCAGAAATGAGGG + Intronic
1077932567 11:6750091-6750113 TTATTGGTTTTGAGCAATGATGG + Intergenic
1077966167 11:7135937-7135959 TTGATAGTCTTGGGGAATGAAGG - Intergenic
1079170251 11:18086948-18086970 TTTCTGTTCTTGAAGAATGATGG + Exonic
1079746484 11:24138346-24138368 TTACAGATCTTGAGGAATAATGG + Intergenic
1081716951 11:45257290-45257312 TTCCTGGTCCTCAGGATTGAAGG + Intronic
1084858117 11:72001654-72001676 TGGCTGACCTTGAGGAATGCTGG - Intronic
1084905986 11:72347914-72347936 TTGCTGGCTTTGAGGATGGATGG + Intronic
1085995903 11:81913694-81913716 TTTGTGGTCTTGTGGAAGGATGG - Intergenic
1086071484 11:82804318-82804340 TTGATGATATTGAGGAATTATGG + Intergenic
1086289320 11:85289271-85289293 GTGCTGGTGGTGAGGAAAGAGGG - Intronic
1087849596 11:103012740-103012762 TAGCTGGTTATGAGGAATGAAGG + Intergenic
1088129677 11:106472333-106472355 TTGCTGGTATTGATGAATGTAGG + Intergenic
1088449267 11:109964665-109964687 TTGCTGGTCTTGCCAGATGAAGG - Intergenic
1093063864 12:14636090-14636112 CTGCTGGCCTTGTAGAATGAAGG - Intronic
1094693215 12:32790171-32790193 TTAATGGTCTTCTGGAATGAAGG - Intergenic
1098602742 12:72351723-72351745 TTGATGGGCTTTAGGAAAGAAGG - Intronic
1099022221 12:77420881-77420903 TTTCTGGTATTGAAGAATCAAGG - Intergenic
1099309502 12:81000467-81000489 TTAGTGGGATTGAGGAATGAGGG + Intronic
1101348644 12:103907439-103907461 TTGGTGGTCATCAGGATTGAAGG - Intergenic
1101966990 12:109288205-109288227 CTGCTGGGCTGGAGGAATGGTGG + Intronic
1103050872 12:117778535-117778557 TGGATAGTCTTGAGAAATGAAGG + Intronic
1104418242 12:128613523-128613545 TTGCTAGTCTTTAAAAATGAGGG - Intronic
1106341103 13:28827747-28827769 TTGCTGGTTTTGCGGCTTGAGGG - Intronic
1106997483 13:35503634-35503656 TTGCTGGTATTGAGAATTCATGG + Intronic
1107520460 13:41175475-41175497 TTGCTGGTTTTGTGGCTTGAGGG - Intergenic
1107546343 13:41437024-41437046 TAGCTGTTCTTGATGTATGATGG + Intergenic
1107901819 13:45024089-45024111 TTGCTGGTCTCCAGCACTGATGG - Intronic
1112787104 13:102963187-102963209 TTGATGGTTTTGAGGAGTGCTGG + Intergenic
1113973574 13:114209562-114209584 CTGATGGTCTAGAGGAAGGAAGG + Intergenic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1115272286 14:31566822-31566844 TTGCTGGCCTTGAAGACAGAAGG + Intronic
1116027661 14:39534718-39534740 TTGCTGGTTTAAGGGAATGAGGG - Intergenic
1116237430 14:42297147-42297169 TTGCTGGTTTTGAGGCTTGCGGG - Intergenic
1119406815 14:74404128-74404150 TAGCTGGTCGTGATGGATGATGG - Intergenic
1120748739 14:88177664-88177686 CTGGTGCTCTTGTGGAATGATGG + Intergenic
1121099405 14:91239899-91239921 TTGCTGGTTTTGTGGCTTGAGGG - Intronic
1121338558 14:93091854-93091876 TTGCTGGGCGTGAGGGATGACGG + Intronic
1122445827 14:101767854-101767876 TTGCTGCCCTTGAGGCTTGAGGG + Intronic
1122828675 14:104384756-104384778 TTGCTGGACTTGGGGACAGAAGG + Intergenic
1124881448 15:33646345-33646367 TTCCAGGTCATGAGGATTGATGG + Exonic
1125183301 15:36902081-36902103 TGGGTGGTTTTGAGGATTGAGGG + Intronic
1126496374 15:49295123-49295145 TTGCTGGTATCTAGGAGTGAAGG + Intronic
1126743481 15:51801352-51801374 TTGCTTTACTTGAGAAATGAGGG + Intronic
1127347787 15:58118361-58118383 TTGCTGGTTTTGGGAGATGAGGG + Intronic
1128304751 15:66590876-66590898 TTGCTGGCCTTGAAGATGGAGGG - Intronic
1128856081 15:71016996-71017018 TTGTTGGGCTTGAGGCAGGAGGG + Intronic
1129128531 15:73467959-73467981 TTGCTGGCATTGAGGATGGAAGG - Intronic
1129763091 15:78143180-78143202 TTGACCGTCATGAGGAATGAAGG + Intronic
1129859159 15:78846981-78847003 CTGCTGGTCCTGGGCAATGAGGG + Intronic
1130009890 15:80142904-80142926 TTGCTGGTTTACTGGAATGAGGG - Intergenic
1131102737 15:89706015-89706037 GAGCTGGTCTTGAAGAATGGGGG - Intronic
1132159073 15:99520006-99520028 TGGTTGGTGTTGAGGACTGAAGG + Intergenic
1135158795 16:20075244-20075266 TTGCTGGTCTTGAGGGACAGGGG - Intergenic
1135537572 16:23305862-23305884 TAGCTGCTCTTTATGAATGAGGG - Intronic
1136635303 16:31517642-31517664 TTGCTGGTTTTGTGGCTTGAGGG + Intergenic
1137054834 16:35739768-35739790 TTACTGTTCTTCAGGAATGTGGG + Intergenic
1137832278 16:51555157-51555179 TTTCTGGTTTTGAGGAATGAAGG + Intergenic
1137909595 16:52363127-52363149 TAGTTGGTCTTGCAGAATGATGG + Intergenic
1138500546 16:57440445-57440467 TTGCTGGTTTTGCGGCTTGAGGG + Intronic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1138888741 16:61114871-61114893 TTGCTGGCCTTGAAGATGGAAGG + Intergenic
1139752322 16:69116701-69116723 CTGCTGCTTTTGGGGAATGAGGG + Exonic
1140540248 16:75750270-75750292 TGGTTGATCTTGAGGAATGTGGG - Intronic
1140758280 16:78088577-78088599 TTGCTGGCCTTGAAGACAGAAGG - Intergenic
1144759282 17:17698324-17698346 TTGCTGTTCTTGAGTACTGGTGG - Intronic
1146311495 17:31771935-31771957 TTGCTTGACTTCAGGAGTGAAGG - Intergenic
1146638132 17:34520976-34520998 TTCCTGGTCTTTAAAAATGAAGG + Intergenic
1147770876 17:42867125-42867147 CTGCTGGTCAAGAGGAATGATGG - Intergenic
1150636975 17:66919836-66919858 AGGCTGGTCAGGAGGAATGAAGG - Intergenic
1156933213 18:42670469-42670491 TTGATGGTCTTTAGGTCTGAAGG + Intergenic
1161452464 19:4354178-4354200 TTGCTGGTCTTGGGGTAGCAAGG + Intronic
1162126874 19:8504207-8504229 TTGCAGTTCTGGAGGAGTGAGGG + Intergenic
1162512801 19:11129836-11129858 TTGGTGGTGTAGAGGAATGTTGG + Intronic
1164416540 19:28050527-28050549 CTGCTGGTTTTGAGGACTGCGGG - Intergenic
1165710320 19:38006158-38006180 TTGCTGGTCTAGGGGAGTGGTGG + Intronic
1166142269 19:40811491-40811513 TTCCTGGGCCTGAGGAATGAGGG - Intronic
1166185254 19:41135303-41135325 TTCCTGGACCTGAGGAATGAGGG + Intergenic
1166376551 19:42330745-42330767 TTCCTGGCCCAGAGGAATGAAGG + Intronic
924986053 2:270992-271014 TTGCTGGTCTAAAGTAAGGATGG + Intronic
925517007 2:4693715-4693737 CTGCTGGTCTTGGGGAATTAGGG + Intergenic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926617775 2:15015269-15015291 TTGCTGGCCTTGTAAAATGAGGG - Intergenic
926914990 2:17882583-17882605 TTGCTGGTCTTGACTACTGTGGG + Intronic
927073802 2:19556463-19556485 TTGCTGCTCTTCAGAAAGGAGGG - Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
928652436 2:33417408-33417430 GTACTGGTCATGAGGAATGTGGG - Intergenic
928671002 2:33603385-33603407 TTGCTGGTCTTGATGAAGGAGGG - Intergenic
930096120 2:47568723-47568745 TTGCTGGGCTTGAGAAGTGAGGG - Intronic
931885377 2:66611439-66611461 TTGCTGGTGTATAGGAATGCTGG + Intergenic
933265773 2:80179086-80179108 TTGCTGGTCTTGACAGCTGAAGG + Intronic
933459995 2:82570288-82570310 TTGCTGGTTTTGCGGCTTGAGGG + Intergenic
935156090 2:100484867-100484889 TTGTTGTTATTGAGGACTGAGGG + Intergenic
936694855 2:114933916-114933938 TTGCTGATCTAGAGGAAGGAAGG + Intronic
936976589 2:118226989-118227011 ATGGTGGTCATAAGGAATGAGGG + Intergenic
937494950 2:122408562-122408584 TTGCTGGTGTTATGGACTGAAGG + Intergenic
939901854 2:147860169-147860191 CAGCTGGTGGTGAGGAATGAAGG - Intronic
941693354 2:168525144-168525166 AGACTGGTCTTAAGGAATGAAGG - Intronic
941844581 2:170120474-170120496 TTTGTGGTCGTGAGAAATGAAGG - Intergenic
943585087 2:189729322-189729344 TTGCTGACCTTGATGAATGCAGG + Intronic
946025982 2:216671936-216671958 GTGCTTGTCTTGGGGGATGAGGG + Intergenic
946132996 2:217622081-217622103 TTTCTGGGCTTGGGGAATGCAGG - Intronic
947058194 2:226131844-226131866 TTGCTGGTGTTGCTGAATGGGGG - Intergenic
948184083 2:236005665-236005687 TTGAAGGTCTTGAGGCATGCTGG + Intronic
948618056 2:239214256-239214278 GTGCTGGTGTTGAGGAGAGAAGG - Intronic
948884320 2:240875304-240875326 TTGGGGTTCTTGAGGCATGAAGG - Intronic
1170300866 20:14883031-14883053 TTCTTGGTCATGAGTAATGATGG + Intronic
1171307494 20:24118780-24118802 GTGCTGGTCCTGATGAAAGAAGG + Intergenic
1171946948 20:31387355-31387377 TTGCAGGTCCTGAGGCAAGAAGG + Intronic
1174079091 20:47958264-47958286 TTCCTGCTTTTGAGTAATGAAGG + Intergenic
1174138572 20:48397508-48397530 TTCCTGCTTTTGAGTAATGAAGG - Intergenic
1175059034 20:56224902-56224924 TTGCTGGTTTACCGGAATGAGGG + Intergenic
1175147041 20:56904825-56904847 TTGCTGGCCTTGAGGATTGGTGG + Intergenic
1177388142 21:20433509-20433531 CTGCTGGTCCTGAGGAATCCAGG + Intergenic
1181114336 22:20621669-20621691 TTGGTGGCCTTGAGGTAGGAAGG - Intergenic
1181439184 22:22927067-22927089 CTGCTGGGCTTGAGGCAGGAAGG - Intergenic
1182742171 22:32575856-32575878 TTTTTTGTCTTGAGGAAAGAAGG - Intronic
1183243696 22:36677303-36677325 TTGGTGGTATTTTGGAATGATGG - Intronic
1183813517 22:40278649-40278671 TTGCTGCTCTGGAGGAATCCAGG + Intronic
1184850141 22:47115227-47115249 TTGCTGGTCCTCAGGAAGGGTGG + Intronic
949565235 3:5238257-5238279 TTGCTGGAATTGGAGAATGAGGG + Intergenic
950220746 3:11194025-11194047 TTGCTGGTCTTGAAGTTTGTTGG + Intronic
951212266 3:19988658-19988680 TTGCTGGTTTTGTGGCTTGAGGG + Intronic
951327474 3:21321039-21321061 TTACTGTTTTTGAGGAATGCTGG - Intergenic
952930761 3:38359331-38359353 TTGCTGGTTTACCGGAATGAGGG - Intronic
953477326 3:43216610-43216632 TTGATGATTTTGAGGAGTGATGG - Intergenic
954089427 3:48272577-48272599 TTCGAGGTCTTGTGGAATGATGG - Intronic
954521141 3:51227746-51227768 TTGCTGGTCTTGATGAACTAGGG - Intronic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
957469149 3:80636186-80636208 TTGCTGGTTTTGAGGCTTGTGGG - Intergenic
960255899 3:115511340-115511362 TTGCTGGTTTTGAAGAAGAAAGG + Intergenic
962672081 3:137718628-137718650 TTGTTGGTGTATAGGAATGATGG + Intergenic
962936617 3:140087215-140087237 TTGCTGAACTTCAGGAAGGAGGG + Intronic
962936806 3:140089084-140089106 TAGCAGGTCTTCAGGAAAGAGGG - Intronic
964117273 3:153149320-153149342 GTGCTGTTCGTGAGGAATTAAGG - Intergenic
965928887 3:174017681-174017703 TTGCTGGTTTTGCGGCTTGACGG - Intronic
967651691 3:191993832-191993854 TTGCTGGTTTTGCGGCTTGAGGG - Intergenic
969968620 4:11022819-11022841 TTTCTGGTCTTGAGGGAAGGAGG + Intergenic
970633741 4:17983571-17983593 TTGTTGGTGTATAGGAATGAGGG + Intronic
970742603 4:19255471-19255493 TTGCTGGTTTTGAGGCTTGGGGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972973975 4:44610627-44610649 CTGCTGCTTATGAGGAATGATGG + Intergenic
976010594 4:80483183-80483205 TTGCTGGCTTTGAGGGCTGAAGG + Intronic
976560089 4:86491003-86491025 TAGCTAGTTTTGAGGACTGAGGG - Intronic
976839133 4:89410800-89410822 CTGCTAGTGTTGAGGAATGCAGG + Intergenic
976944267 4:90745231-90745253 TTGCTGGTTTTGAAGATAGACGG - Intronic
977302457 4:95282943-95282965 TGGCTGGTCTTGGGGAAGAATGG + Intronic
977457326 4:97277845-97277867 TTGCTGGATTTGAAGAAGGAAGG + Intronic
978016292 4:103750449-103750471 TTGCTGTTCTGGCAGAATGAGGG - Intergenic
981510917 4:145557533-145557555 TTGCTGGTCTTGAGGAATGAAGG - Intronic
985699888 5:1364440-1364462 TGGCTGGGCTTGGGGAATAATGG + Intergenic
986289206 5:6385312-6385334 CTGCTGGTCTTGAGCAGAGAAGG - Intergenic
986742828 5:10718802-10718824 TTGCTGGTCTTGCCAGATGAAGG - Intronic
986764864 5:10916147-10916169 TTTCTGGCCTTGAAGGATGAAGG - Intergenic
986796354 5:11216470-11216492 TTGCTGGCTTTGAAGAGTGAAGG + Intronic
987152207 5:15054842-15054864 TAGCTGTTCTTCAGAAATGAAGG - Intergenic
987594450 5:19978711-19978733 TTGCTGGTTTTGGAGTATGAAGG - Intronic
988183606 5:27831285-27831307 TTGCTGGTTTTGAAGATGGAGGG + Intergenic
988374671 5:30420432-30420454 TTGATGGTTTTGAGGAGTGCTGG + Intergenic
988666202 5:33330569-33330591 TTGCTGGTGCTGAGGACGGAAGG - Intergenic
991486902 5:67146292-67146314 TTGCTGGTCATTAGTAATGGAGG + Intronic
993837612 5:92834898-92834920 CTGCTGGCTTTGAGGAATCAAGG - Intergenic
994603134 5:101933404-101933426 TTGATGGTTTTGAGGAACGTTGG - Intergenic
994744654 5:103663722-103663744 TTGCTGGTTTTGGGGCTTGAGGG - Intergenic
996047348 5:118888265-118888287 TTGCTAGCCTTGATGGATGAAGG - Intronic
996923328 5:128794411-128794433 TTGCTGATCTTGAATAATTAAGG - Intronic
997073429 5:130643546-130643568 TTGCTGGTTTACTGGAATGAGGG - Intergenic
998290425 5:140909243-140909265 TTGCTGGCCTTGCTGACTGAAGG + Intronic
1000345331 5:160309597-160309619 TCGCCTTTCTTGAGGAATGAGGG - Intronic
1000811114 5:165863234-165863256 TTGCTGGTTTTGAGCAGAGAGGG - Intergenic
1001113743 5:168921500-168921522 TTGCTGATATAGAGGAAGGAAGG + Intronic
1001820624 5:174707391-174707413 TTGTTGGTAATGAGGAATGTTGG + Intergenic
1001959359 5:175871177-175871199 TTGCTGCTCCTGAGGAGTGGTGG - Intronic
1003344748 6:5256785-5256807 TAGCTGGTCTTGTGGAGAGAGGG - Intronic
1003491959 6:6630624-6630646 TTGTTGTTCTTGAGGATTGAGGG - Intronic
1003721012 6:8702082-8702104 TTACTGGTTTTAAGCAATGAAGG - Intergenic
1004777378 6:18863079-18863101 TTGATGGTTTTGAGGAATATTGG + Intergenic
1005060571 6:21773511-21773533 TTGTTGCTGTTGATGAATGAAGG + Intergenic
1006622998 6:35379946-35379968 TTGCTGCTTTTGAGGTATCAAGG + Intronic
1007327754 6:41074514-41074536 TGACTGGCCTTGAAGAATGATGG + Intronic
1008093206 6:47313057-47313079 TTGCAGGTTTACAGGAATGAGGG - Intergenic
1014789570 6:125657076-125657098 TTGGTGGTGTTGAGGATTGGGGG + Intergenic
1015006712 6:128291230-128291252 TCGCTGGTCTTGAAGACAGAAGG + Intronic
1015136587 6:129879081-129879103 TTGTTGGTGTAGAGGAATGCTGG + Intergenic
1015897869 6:138034597-138034619 TTGTTGGCCTAGAGGAATTAGGG - Intergenic
1016176069 6:141078881-141078903 TTGGTGTTCCTGAGGAATAATGG + Intergenic
1017691630 6:156971747-156971769 TGGCTGGCCTTGAGGAAGCAAGG - Intronic
1019871732 7:3770045-3770067 TTACTGGTTATGAGGAGTGAGGG + Intronic
1020909298 7:14108684-14108706 TTGCTGGTTTTGAGGCTTGTGGG - Intergenic
1022839761 7:34152278-34152300 TTCCTATTCTTGAGGAATGAGGG + Intronic
1024002222 7:45197839-45197861 TTGCTGGTCTGGCGTAATGAAGG - Intergenic
1026343683 7:69455714-69455736 TTGATTGACGTGAGGAATGATGG + Intergenic
1028185937 7:87785298-87785320 AGGCTGGTCTTGTGGAAGGAAGG + Intronic
1028784021 7:94771966-94771988 TTGATGGTTTTGAGAAATGCTGG - Intergenic
1030431734 7:109456402-109456424 TGGCTGCTGTTGGGGAATGAGGG + Intergenic
1032098204 7:128950549-128950571 TTGATGGTTTTGAGGAATACTGG + Intergenic
1032937064 7:136745305-136745327 TTGCTGGTTTTGTGGCTTGAGGG - Intergenic
1033197793 7:139342013-139342035 TTGCTGCCCTTGAGCAATGTGGG + Intronic
1036461014 8:8952673-8952695 TTGTTAGTCTTGTGGAGTGAGGG - Intergenic
1038185267 8:25267702-25267724 TTGATGGGCATGGGGAATGAGGG + Intronic
1038991930 8:32877652-32877674 TTGCTGGTTTTGAGGCTTGGGGG + Intergenic
1041959173 8:63592758-63592780 TAGCTGTTCTTCAGAAATGAAGG - Intergenic
1042056529 8:64769943-64769965 TTGCTGGACTTCAGAAAGGAAGG - Intronic
1042659938 8:71143152-71143174 TTGCTGGTCTTGAGGTAGAAAGG - Intergenic
1042874688 8:73430199-73430221 TTGCTGGGCTTGTGGCATGTAGG + Intronic
1045873548 8:106952496-106952518 TTTCAGATCTTGAGGAATGTTGG + Intergenic
1047142242 8:122154162-122154184 CTGCAGGTCATGATGAATGAAGG - Intergenic
1048247059 8:132817035-132817057 TTGCTGATTTTGAGAACTGATGG - Exonic
1049857373 8:144871167-144871189 TTGCAGGTTTACAGGAATGAGGG + Intergenic
1050680845 9:8109663-8109685 TTGAGGGTAATGAGGAATGAGGG - Intergenic
1051539175 9:18195135-18195157 TTGTTTGTTTTGAGGAATGAGGG + Intergenic
1052989172 9:34508646-34508668 CTGCTTGGCTTGAGGAAGGAAGG - Intronic
1053703612 9:40727287-40727309 TTGCTGGTCTTGCGGCTTGGGGG + Intergenic
1054413670 9:64850750-64850772 TTGCTGGTCTTGCGGCTTGGGGG + Intergenic
1056245969 9:84695916-84695938 TTGCTGGATTTGAAGAATCATGG + Intronic
1056894905 9:90536130-90536152 TTGCTGGTTTTGCGGCTTGAGGG - Intergenic
1057303742 9:93900868-93900890 TTGCTGGTTTTGAAGACGGAGGG - Intergenic
1058038275 9:100276805-100276827 TGGCTGGTATTTAAGAATGAGGG - Intronic
1058114157 9:101066134-101066156 TTGACGGTTTTGAGGAATGCTGG + Intronic
1062373098 9:136250250-136250272 GGGCTGGTCGTGAGGAACGAAGG - Intergenic
1185873239 X:3681789-3681811 TTGCTGGGCTTGAGGAAGAGAGG - Intronic
1187038002 X:15563039-15563061 TTGCTGGGCTTATGGAATGAAGG - Intronic
1187144358 X:16624095-16624117 GTGCTGGTCTTAAGAATTGAGGG - Intronic
1188595817 X:31898691-31898713 TTTCTTTTCTTAAGGAATGATGG + Intronic
1189182319 X:39016015-39016037 TTGCTGGTGTTGATAAATGCTGG + Intergenic
1191977761 X:66892687-66892709 TTTCTGGTCTAGAGAAATTAAGG - Intergenic
1193301753 X:79897205-79897227 TTGCTGGTTTTGCGGCTTGAGGG + Intergenic
1196514080 X:116549104-116549126 TTGATGTTGCTGAGGAATGAGGG + Intergenic
1197134774 X:123048388-123048410 TTGCTGGCTTTGAGGATGGAAGG + Intergenic
1198630017 X:138626169-138626191 TTTCTGGTAATGAGGTATGATGG + Intergenic
1199613722 X:149639061-149639083 TTCATGGTTTTGAGGAATGCTGG - Intergenic
1199769399 X:150964793-150964815 TTGCCGGTGTTCAGGGATGAAGG - Intergenic
1200791063 Y:7299324-7299346 TTGCTGGGCTTGAGGAAGAGAGG + Intergenic
1201610428 Y:15837064-15837086 ATCCTGGTGTTGAGAAATGATGG + Intergenic
1201766458 Y:17577425-17577447 GCTCTGGTCTTTAGGAATGAGGG - Intergenic
1201835094 Y:18328564-18328586 GCTCTGGTCTTTAGGAATGAGGG + Intergenic