ID: 981511885

View in Genome Browser
Species Human (GRCh38)
Location 4:145566554-145566576
Sequence GCTTCCTTTTCCCCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981511879_981511885 22 Left 981511879 4:145566509-145566531 CCCCCAACATCACTACGCCAGTG No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data
981511878_981511885 25 Left 981511878 4:145566506-145566528 CCACCCCCAACATCACTACGCCA No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data
981511882_981511885 19 Left 981511882 4:145566512-145566534 CCAACATCACTACGCCAGTGCAT No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data
981511883_981511885 5 Left 981511883 4:145566526-145566548 CCAGTGCATGTGTGCATCAGCAG No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data
981511881_981511885 20 Left 981511881 4:145566511-145566533 CCCAACATCACTACGCCAGTGCA No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data
981511880_981511885 21 Left 981511880 4:145566510-145566532 CCCCAACATCACTACGCCAGTGC No data
Right 981511885 4:145566554-145566576 GCTTCCTTTTCCCCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981511885 Original CRISPR GCTTCCTTTTCCCCACCAGC AGG Intergenic
No off target data available for this crispr