ID: 981515065

View in Genome Browser
Species Human (GRCh38)
Location 4:145598849-145598871
Sequence AGGTGGAAAAGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981515058_981515065 1 Left 981515058 4:145598825-145598847 CCTGTTGCATCATTTCATAGTGG No data
Right 981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG No data
981515057_981515065 5 Left 981515057 4:145598821-145598843 CCTTCCTGTTGCATCATTTCATA No data
Right 981515065 4:145598849-145598871 AGGTGGAAAAGGAAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981515065 Original CRISPR AGGTGGAAAAGGAAGGTGGA AGG Intergenic
No off target data available for this crispr