ID: 981516926

View in Genome Browser
Species Human (GRCh38)
Location 4:145619501-145619523
Sequence GGCGCCCCCTGGAGGATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 151}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981516911_981516926 9 Left 981516911 4:145619469-145619491 CCTCCCGCCGGGGGGCCAGCGCG 0: 1
1: 0
2: 0
3: 18
4: 190
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516904_981516926 20 Left 981516904 4:145619458-145619480 CCTACGGCCGCCCTCCCGCCGGG 0: 1
1: 0
2: 0
3: 14
4: 214
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516909_981516926 13 Left 981516909 4:145619465-145619487 CCGCCCTCCCGCCGGGGGGCCAG 0: 1
1: 0
2: 5
3: 32
4: 489
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516902_981516926 23 Left 981516902 4:145619455-145619477 CCGCCTACGGCCGCCCTCCCGCC 0: 1
1: 0
2: 4
3: 19
4: 296
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516913_981516926 6 Left 981516913 4:145619472-145619494 CCCGCCGGGGGGCCAGCGCGGTC 0: 1
1: 0
2: 0
3: 10
4: 123
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516915_981516926 2 Left 981516915 4:145619476-145619498 CCGGGGGGCCAGCGCGGTCCTCC 0: 1
1: 0
2: 0
3: 19
4: 218
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516914_981516926 5 Left 981516914 4:145619473-145619495 CCGCCGGGGGGCCAGCGCGGTCC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516910_981516926 10 Left 981516910 4:145619468-145619490 CCCTCCCGCCGGGGGGCCAGCGC 0: 1
1: 0
2: 1
3: 20
4: 208
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516919_981516926 -6 Left 981516919 4:145619484-145619506 CCAGCGCGGTCCTCCGGGGCGCC 0: 1
1: 0
2: 3
3: 5
4: 136
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151
981516901_981516926 24 Left 981516901 4:145619454-145619476 CCCGCCTACGGCCGCCCTCCCGC 0: 1
1: 0
2: 2
3: 15
4: 206
Right 981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981516926 Original CRISPR GGCGCCCCCTGGAGGATTTG GGG Intronic
900476861 1:2880130-2880152 TGCACCCCCTGTAGGACTTGGGG + Intergenic
900892708 1:5461055-5461077 GGTTCCTCCTGGAGGATTTACGG - Intergenic
901879748 1:12186795-12186817 GGGGGCCCCTGAAGGACTTGGGG + Intronic
903879695 1:26500511-26500533 GGAGCCCGCTGGAGGAGTGGAGG - Intergenic
904190064 1:28736734-28736756 TGCGCCCTCTGGCGGATTGGAGG - Intronic
904479147 1:30783207-30783229 GGCCTCCCCTGGAGGAAGTGGGG + Intergenic
904595796 1:31644599-31644621 GTCGCTCACTCGAGGATTTGGGG - Intronic
905313872 1:37068807-37068829 GGAGACAGCTGGAGGATTTGAGG - Intergenic
909679594 1:78277132-78277154 TGCTCCTCCTGGAGGATTTCAGG - Intergenic
911335581 1:96576329-96576351 GGCTCTCCCTGGTGCATTTGAGG - Intergenic
914928629 1:151909806-151909828 CGCGCCGACTGGAGGCTTTGCGG + Exonic
915475937 1:156152949-156152971 GGCTCCCCCTGGAGCCTTTAGGG + Intronic
915725433 1:158013892-158013914 GGTGGTCCCTGGAGGATTTTAGG + Intronic
919940966 1:202285883-202285905 GGTGCCTTCTGGAGGGTTTGAGG + Intronic
1067948113 10:50703888-50703910 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1069728752 10:70598084-70598106 GGCTCCCCCAGAAGCATTTGGGG + Exonic
1070883425 10:79868886-79868908 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1071649991 10:87385193-87385215 GGAGCCTGCTGGAGGCTTTGTGG + Intergenic
1072531305 10:96321999-96322021 GGCGCCCCCAGGTGGAACTGAGG - Intronic
1076160735 10:128242726-128242748 CACGCCCCCTGGTGGATTTCTGG + Intergenic
1076291875 10:129351760-129351782 TGCTCCCACTGGAGGCTTTGGGG - Intergenic
1076944538 10:133637361-133637383 GGCGCCCCCTGGAGCCCTGGCGG - Intergenic
1084120535 11:67066471-67066493 GGCACCGCCTGGAGGAACTGGGG - Intronic
1084146117 11:67266327-67266349 GGCGCCCCCTGGAGGCCGCGCGG - Intergenic
1086934369 11:92728707-92728729 GGCACCCTCTGGAGGTTCTGGGG + Intronic
1089729365 11:120511226-120511248 GGCGCCCCCTGGTGGCATTCGGG - Intergenic
1091593275 12:1858045-1858067 GGACTCCCCTGGAGGCTTTGTGG + Intronic
1095967306 12:47877715-47877737 GGCCCACCCTGCAGGATGTGTGG + Intronic
1096838770 12:54368837-54368859 GGCGCCGCCTTGTGGAGTTGTGG + Intergenic
1097195209 12:57239219-57239241 GGCGCCCCCTGGAGGCCGAGCGG + Intronic
1102252497 12:111397086-111397108 GGCGCCCCCTGGTGGCTGTGGGG - Intergenic
1103613430 12:122137767-122137789 TGGGCCCCCTGGAGGCTTTTGGG + Intronic
1104000445 12:124856782-124856804 GGCGGCCCCTGCAGGATGGGTGG + Intronic
1108003341 13:45924318-45924340 AGAGTCCCCTGGAGGGTTTGGGG - Intergenic
1111914386 13:94345896-94345918 TGCGCCCCCTGAAGGATCTAGGG + Intronic
1113723119 13:112575904-112575926 GGCTACCCCTGGAGGCTCTGGGG - Intronic
1117486844 14:56206031-56206053 GGCGCTCCCAGGAGGAAGTGTGG + Intronic
1119910968 14:78348892-78348914 GGTGCCCACTGGAGCACTTGGGG - Intronic
1123144605 14:106116560-106116582 GGCGCCCCCTGGTGGTCCTGGGG + Intergenic
1123156811 14:106234987-106235009 GGCGCCCCCTGGTGGTCCTGGGG + Intergenic
1123203647 14:106691895-106691917 AGCGCCCCCTGCAGGTTCTGAGG + Intergenic
1123207582 14:106728088-106728110 GGCGCCCCCTGGTGGTCCTGGGG + Intergenic
1123212593 14:106775082-106775104 GGCGCCCCCTGGTGGTCCTGGGG + Intergenic
1202917935 14_KI270723v1_random:2693-2715 GGCGCCCCCTGGAGCCCTGGTGG - Intergenic
1127577631 15:60307511-60307533 TGAGCCCACTGGAGGTTTTGAGG + Intergenic
1128311651 15:66634701-66634723 GGCTGCCCCGGGAGGAGTTGAGG + Intronic
1129032214 15:72627705-72627727 GGGGCCCACAGGAGGATTTTAGG - Intergenic
1129217682 15:74109534-74109556 GGGGCCCACAGGAGGATTTTAGG + Intronic
1129294897 15:74594820-74594842 GGAGGCCCCTGGAGGAGGTGGGG + Intronic
1129470181 15:75749313-75749335 GGGGCCCACAGGAGGATTTTAGG - Intergenic
1129597317 15:76974869-76974891 GGCAGCCCCTGGTGGATATGTGG - Intergenic
1129615308 15:77094549-77094571 GGCGCCCTCCGGAGGCTTAGGGG - Intergenic
1129734846 15:77953829-77953851 GGGGCCCACAGGAGGATTTTAGG + Intergenic
1129840745 15:78742162-78742184 GGGGCCCACAGGAGGATTTTAGG - Intergenic
1132149389 15:99448618-99448640 GGCAAACCCTGGAGGAATTGTGG - Intergenic
1132330011 15:101005751-101005773 GGCTCCCCCTGGACAAATTGGGG + Intronic
1132702333 16:1227160-1227182 CACGCCCACTGGAGGTTTTGCGG - Intergenic
1132705992 16:1243708-1243730 CACGCCCACTGGAGGTTTTGCGG + Intergenic
1132950191 16:2557490-2557512 GGCGCTGCCTGGTGGATTAGCGG + Intronic
1132964155 16:2642680-2642702 GGCGCTGCCTGGTGGATTAGCGG - Intergenic
1134090728 16:11390399-11390421 TGCGGCCCCTGGAGGAGGTGTGG - Exonic
1136872099 16:33816724-33816746 AGCGCCCCCTGGTGGTTCTGAGG - Intergenic
1138565153 16:57827706-57827728 TGTGCCCACTGGAGGGTTTGTGG - Intronic
1139673991 16:68510339-68510361 GGCGCCCCCTGCAGGTTGTACGG + Intergenic
1141570170 16:84929400-84929422 GCCTCTCCCTGGAGGATTTCTGG - Intergenic
1141921103 16:87136033-87136055 GGTGACCCATGGAGGAGTTGGGG + Intronic
1142185715 16:88693882-88693904 GGCTCGCCCTGGAGGAGCTGGGG - Intergenic
1203100073 16_KI270728v1_random:1299344-1299366 AGCGCCCCCTGGTGGTTCTGAGG + Intergenic
1146716337 17:35089458-35089480 CGCGCCCCCTGGCGGAGCTGAGG + Intronic
1150130970 17:62668786-62668808 GGGGCCTCGTGGAGGAGTTGGGG + Intronic
1151170279 17:72239836-72239858 GGAGACCCCTGCAGGACTTGTGG - Intergenic
1152241969 17:79165613-79165635 GGAGCCCCCTGGAGAAATTCTGG + Intronic
1152438275 17:80289134-80289156 AGTGCCCCCAGGAGGAGTTGGGG + Intronic
1152585792 17:81188920-81188942 GCTGCCCCCCTGAGGATTTGGGG + Intergenic
1152595017 17:81233708-81233730 GCCTCCCCCTGTAGGACTTGGGG - Exonic
1160042779 18:75360739-75360761 GGCTCCTTCTGGAGGATTGGAGG + Intergenic
1161237332 19:3204490-3204512 GGAGGCCCCTGGAGCATTTGGGG + Intronic
1161301339 19:3544456-3544478 CCAGCCCTCTGGAGGATTTGGGG - Exonic
1161512577 19:4679717-4679739 GGGGCTCCCTGGGGGATCTGGGG - Intronic
1162366027 19:10250281-10250303 GGCGCCCCCTGGAGGTCTATCGG + Intergenic
1162585058 19:11553358-11553380 GGCTCCCCCCGGCGGAATTGGGG - Exonic
1163595929 19:18220996-18221018 GGCGCCTCCAGGTGGGTTTGAGG - Intronic
1163615328 19:18323881-18323903 GGCTCCCTCTGGAGGCTCTGAGG + Intergenic
1164883637 19:31758981-31759003 GGAACCCCCTGGGAGATTTGGGG - Intergenic
1167185440 19:47939402-47939424 GGCGCCCCCTGGAGGGATGAAGG - Intergenic
1167586543 19:50378643-50378665 GGCTTCCCCTGGTGGATCTGAGG + Exonic
1168494342 19:56837565-56837587 GGCGCCCCCTGGAGGAAGTAAGG + Intronic
924996622 2:367247-367269 GGGGCCTCCTGGAGGCCTTGGGG + Intergenic
925032640 2:662723-662745 GGTGCCCTCTGGAGGGTTAGTGG + Intergenic
928303496 2:30147223-30147245 GGCCCACCCTGAAGGATCTGGGG - Intronic
928439854 2:31283375-31283397 GGAGCCCTCTTGAGGACTTGAGG - Intergenic
929921171 2:46172504-46172526 GGCGGCCCTGGGAGGGTTTGAGG + Intronic
936660218 2:114534903-114534925 TGGGGCCCCTTGAGGATTTGAGG + Intronic
948687386 2:239677647-239677669 GGGCCCCCCTGGAGGAGGTGTGG - Intergenic
1168806830 20:676520-676542 GGAGCCCCCTGTTGGGTTTGGGG + Intergenic
1170396378 20:15930478-15930500 GGTTCCCCCTGCTGGATTTGAGG + Intronic
1171781892 20:29427353-29427375 GGCGCCCCCTGGAGCCCTGGCGG - Intergenic
1174157421 20:48524797-48524819 GGGGACCCCTGGGGGACTTGGGG - Intergenic
1176042303 20:63072160-63072182 GGCGCCCGCTGCAGGCTCTGGGG - Intergenic
1180594157 22:16962742-16962764 GGCGCCCCTGGGAGGCTCTGAGG + Exonic
1183564225 22:38601636-38601658 GGAGGCCCCTGCAGGAGTTGGGG + Intronic
1183600876 22:38840092-38840114 GGCTCCCACTTGAGGCTTTGGGG + Intronic
1183647578 22:39135291-39135313 GGAGCCCCCTGGAGGGGTCGGGG - Intronic
1183956102 22:41381667-41381689 GGCGCCTGCTGGAGTCTTTGTGG - Intronic
1185018372 22:48358744-48358766 GGAGCCCCCTGGGGGGATTGGGG - Intergenic
1185065229 22:48628708-48628730 GCTGCCCCCGGGAGGATTTTAGG + Intronic
1185398959 22:50606174-50606196 GGGGCCACCTGGAAGATCTGTGG - Intronic
952581477 3:34838478-34838500 GGTTCCTCCTGGAGGATCTGAGG + Intergenic
953033033 3:39190432-39190454 GGCACCCCTGGGAGGATATGAGG + Intronic
954376041 3:50194664-50194686 GGCGCCGCCTGGCGGCCTTGCGG - Intronic
957083610 3:75659044-75659066 GGCGCCCCCTGGAGCCCTGGCGG + Intergenic
963697390 3:148578144-148578166 TGCTCCTCCTGGTGGATTTGTGG - Intergenic
964513289 3:157477165-157477187 GGTGCCCTCTGGAGGCTCTGAGG + Intronic
968647741 4:1748820-1748842 GGCGCCCCCTGCAGGCTGTTGGG - Intergenic
968902760 4:3439103-3439125 GACGCCCCCAGGAGGAATTAGGG + Intronic
981516926 4:145619501-145619523 GGCGCCCCCTGGAGGATTTGGGG + Intronic
985447924 4:190037871-190037893 GGCGCCCCCTGGAGCCCTGGCGG - Intergenic
985889146 5:2702153-2702175 GGAGGTCCCTGGAGGGTTTGTGG - Intergenic
987190423 5:15471557-15471579 GCTACCACCTGGAGGATTTGAGG + Intergenic
992366865 5:76101121-76101143 GGAGCACCCTGGGTGATTTGGGG + Intronic
992367231 5:76105228-76105250 TGCTCCCTCTGGAGGCTTTGAGG - Intronic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1001537445 5:172508225-172508247 GGCTCCCTCTGGAGGCTCTGAGG - Intergenic
1002541299 5:179907948-179907970 GGCGCCCCCTGGCGGGCGTGTGG + Intergenic
1005315047 6:24596282-24596304 GGCTCCCCCTCGGGGATCTGGGG - Exonic
1014286327 6:119503168-119503190 GGCAGCCACTGGAGGAGTTGGGG + Intergenic
1016947254 6:149546348-149546370 GGCGCCCCCTGGTGGATAAAAGG - Intergenic
1019098002 6:169601762-169601784 TGCGCCTCATGGTGGATTTGGGG - Intronic
1019525074 7:1477169-1477191 GTCCCTCCCTGGAGGATGTGGGG + Intronic
1024639455 7:51317118-51317140 GGCGCCTCCTGGCGGAGTTGGGG + Intergenic
1024854435 7:53761428-53761450 GGGGCCCCCTGGCTGAATTGTGG + Intergenic
1027051708 7:75025126-75025148 GGGGTGCCCTGGAGGGTTTGGGG + Intergenic
1027055827 7:75048655-75048677 GGCGCTCCCTGGGGGATGAGGGG + Intronic
1029016519 7:97320408-97320430 GGCACCCAATGGAGGCTTTGAGG - Intergenic
1033654405 7:143362897-143362919 GGCGCTCCCTCGGGGATCTGGGG + Intergenic
1035315084 7:157992644-157992666 GGGGTCCCCTGGAGGGGTTGGGG + Intronic
1036808000 8:11848291-11848313 AGCGTCCCTTGGAGGGTTTGGGG - Intronic
1037802896 8:22044661-22044683 GCCCCACCCTGGAGCATTTGGGG - Intronic
1039862150 8:41468278-41468300 GGTTCCTCCTGGAGGATGTGAGG - Intergenic
1040012510 8:42674232-42674254 GGTGCCCCCTGGAGCATAAGTGG + Intergenic
1047288694 8:123510311-123510333 GGCCCCAACTGCAGGATTTGAGG - Intronic
1048020249 8:130531737-130531759 GGCCCCACCTGCAGCATTTGGGG - Intergenic
1048331731 8:133475290-133475312 GGCTCCTCCTGGAGGCTCTGAGG - Intronic
1049308609 8:141921231-141921253 TGCGCGCCCTGGAGGACTTCAGG + Intergenic
1050532705 9:6604718-6604740 GAGGCCACCTGGAGAATTTGGGG - Exonic
1055303529 9:74905777-74905799 GGTGCCCCATGGAGAATCTGGGG + Intergenic
1055956061 9:81774700-81774722 GGAGACCCCTGGAGGACTTTAGG + Intergenic
1056574918 9:87848791-87848813 GGAGCCTGCTGGAGGCTTTGTGG - Intergenic
1058241575 9:102568924-102568946 GGTGCCCCCTGCAGCATCTGTGG - Intergenic
1060375005 9:123109644-123109666 GGTGCTGCCTGGAGGACTTGTGG + Intronic
1061092385 9:128433962-128433984 GGGGCCCCCAGCAGGCTTTGGGG + Intronic
1061971950 9:134049845-134049867 GGTGCTCCCTGCAAGATTTGGGG - Intronic
1062272791 9:135717495-135717517 GGCTCCCCCTGGAGGCTGCGGGG + Intronic
1062365198 9:136205058-136205080 AGCGTCCCCTGGAGGGTTCGGGG + Intronic
1186839571 X:13471528-13471550 GGAGCCCCCTGCAGGGTTTGGGG + Intergenic
1190326637 X:49210679-49210701 TGCGGCCCCTGGAGGAGTTGGGG + Exonic
1190812236 X:53895993-53896015 GGCGTCTCTGGGAGGATTTGTGG + Intergenic
1197551763 X:127900652-127900674 AGCAACCTCTGGAGGATTTGGGG - Intergenic