ID: 981517397

View in Genome Browser
Species Human (GRCh38)
Location 4:145624814-145624836
Sequence GGACCCATGTAAGGTAGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 2, 1: 0, 2: 1, 3: 6, 4: 112}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981517397_981517406 19 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517406 4:145624856-145624878 AATCCTCTGTAACCATGCTGGGG No data
981517397_981517409 30 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109
981517397_981517404 17 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517404 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
981517397_981517405 18 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517405 4:145624855-145624877 CAATCCTCTGTAACCATGCTGGG 0: 2
1: 0
2: 0
3: 10
4: 110
981517397_981517407 20 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517407 4:145624857-145624879 ATCCTCTGTAACCATGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981517397 Original CRISPR GGACCCATGTAAGGTAGAGG AGG (reversed) Intronic