ID: 981517404

View in Genome Browser
Species Human (GRCh38)
Location 4:145624854-145624876
Sequence CCAATCCTCTGTAACCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 2, 1: 0, 2: 2, 3: 7, 4: 100}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981517400_981517404 8 Left 981517400 4:145624823-145624845 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 981517404 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
981517402_981517404 -4 Left 981517402 4:145624835-145624857 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 981517404 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
981517398_981517404 14 Left 981517398 4:145624817-145624839 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 981517404 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100
981517397_981517404 17 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517404 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 0
2: 2
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981517404 Original CRISPR CCAATCCTCTGTAACCATGC TGG Intronic