ID: 981517407

View in Genome Browser
Species Human (GRCh38)
Location 4:145624857-145624879
Sequence ATCCTCTGTAACCATGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981517397_981517407 20 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517407 4:145624857-145624879 ATCCTCTGTAACCATGCTGGGGG No data
981517398_981517407 17 Left 981517398 4:145624817-145624839 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 981517407 4:145624857-145624879 ATCCTCTGTAACCATGCTGGGGG No data
981517402_981517407 -1 Left 981517402 4:145624835-145624857 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 981517407 4:145624857-145624879 ATCCTCTGTAACCATGCTGGGGG No data
981517400_981517407 11 Left 981517400 4:145624823-145624845 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 981517407 4:145624857-145624879 ATCCTCTGTAACCATGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981517407 Original CRISPR ATCCTCTGTAACCATGCTGG GGG Intronic