ID: 981517409

View in Genome Browser
Species Human (GRCh38)
Location 4:145624867-145624889
Sequence ACCATGCTGGGGGTGTACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 109}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981517400_981517409 21 Left 981517400 4:145624823-145624845 CCTTACATGGGTCCTGATGGTTC 0: 3
1: 0
2: 1
3: 5
4: 69
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109
981517402_981517409 9 Left 981517402 4:145624835-145624857 CCTGATGGTTCTGGACAAGCCAA 0: 3
1: 1
2: 0
3: 5
4: 104
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109
981517397_981517409 30 Left 981517397 4:145624814-145624836 CCTCCTCTACCTTACATGGGTCC 0: 2
1: 0
2: 1
3: 6
4: 112
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109
981517398_981517409 27 Left 981517398 4:145624817-145624839 CCTCTACCTTACATGGGTCCTGA 0: 2
1: 1
2: 1
3: 7
4: 89
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109
981517403_981517409 -10 Left 981517403 4:145624854-145624876 CCAATCCTCTGTAACCATGCTGG 0: 2
1: 1
2: 2
3: 14
4: 159
Right 981517409 4:145624867-145624889 ACCATGCTGGGGGTGTACAATGG 0: 1
1: 1
2: 3
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981517409 Original CRISPR ACCATGCTGGGGGTGTACAA TGG Intronic