ID: 981524538

View in Genome Browser
Species Human (GRCh38)
Location 4:145696774-145696796
Sequence TGTACTCTCAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53280
Summary {0: 1, 1: 9, 2: 247, 3: 4420, 4: 48603}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981524535_981524538 -2 Left 981524535 4:145696753-145696775 CCGGGCACTGTGGCTCACACCTG 0: 352
1: 12737
2: 51498
3: 121252
4: 147279
Right 981524538 4:145696774-145696796 TGTACTCTCAGTACTTCAGGAGG 0: 1
1: 9
2: 247
3: 4420
4: 48603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981524538 Original CRISPR TGTACTCTCAGTACTTCAGG AGG Intronic
Too many off-targets to display for this crispr