ID: 981526316

View in Genome Browser
Species Human (GRCh38)
Location 4:145709769-145709791
Sequence TCATGAGCTCCCTATTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981526309_981526316 17 Left 981526309 4:145709729-145709751 CCCAAGCATTGCATGGGTTTAGG 0: 1
1: 0
2: 3
3: 21
4: 122
Right 981526316 4:145709769-145709791 TCATGAGCTCCCTATTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 85
981526311_981526316 16 Left 981526311 4:145709730-145709752 CCAAGCATTGCATGGGTTTAGGC 0: 1
1: 0
2: 1
3: 15
4: 69
Right 981526316 4:145709769-145709791 TCATGAGCTCCCTATTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 85
981526308_981526316 18 Left 981526308 4:145709728-145709750 CCCCAAGCATTGCATGGGTTTAG 0: 1
1: 0
2: 1
3: 16
4: 100
Right 981526316 4:145709769-145709791 TCATGAGCTCCCTATTTAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981526316 Original CRISPR TCATGAGCTCCCTATTTAGG AGG Intronic
904119424 1:28187242-28187264 AGATGAGCTCTCTATTTATGGGG - Intronic
918335199 1:183503607-183503629 TCATGAGATCCCTTTTGAAGGGG - Intronic
922111135 1:222556928-222556950 TTATGGACTCCCTATTTATGTGG + Intergenic
922933853 1:229409389-229409411 TAATGAGCTGCCTGCTTAGGAGG - Intergenic
923674213 1:236065630-236065652 TCCTGTGCTCCCTATTGTGGAGG + Intergenic
1068449073 10:57163629-57163651 TTATGGGCTTCTTATTTAGGAGG - Intergenic
1069108950 10:64420065-64420087 TGATGAGCACACTATTTTGGAGG + Intergenic
1072234805 10:93444524-93444546 ACATGAGCTCCCTAATAAGAAGG + Intronic
1073552641 10:104417272-104417294 TGATGAGCTCCATATTTCAGAGG - Intronic
1073976669 10:109109737-109109759 TCATGAACACCATTTTTAGGGGG + Intergenic
1081605130 11:44522338-44522360 CCATTAATTCCCTATTTAGGAGG + Intergenic
1082772755 11:57221210-57221232 ACATGAGATCCCAGTTTAGGTGG - Intergenic
1086042870 11:82499980-82500002 TAAGGAGCTCCCGATGTAGGAGG + Intergenic
1089746952 11:120624256-120624278 TCTTGAGCTCTCTATTGGGGTGG - Intronic
1093523709 12:20080908-20080930 TCAAGAGCTCTCTATGAAGGAGG + Intergenic
1097502884 12:60428041-60428063 TTAAGTGCTCCCTATTTGGGAGG + Intergenic
1110657694 13:78019968-78019990 TCATGGGCTGCCTCATTAGGAGG + Intergenic
1117762925 14:59051092-59051114 TCATGAGCACAAAATTTAGGGGG + Intergenic
1119362343 14:74061650-74061672 TCATGAGCTCTATATTGAAGTGG + Intronic
1125064453 15:35465724-35465746 TCATGAGCTCACTGTTTAATGGG - Intronic
1125159410 15:36626674-36626696 TCATGAGCTTCCTAAGTGGGAGG + Intronic
1134138677 16:11697791-11697813 TGTTGAGCTTCCTGTTTAGGGGG - Intronic
1138542918 16:57699250-57699272 TCAGCAGCTGCCTCTTTAGGCGG - Intronic
1141420784 16:83914202-83914224 TCATGAGATCTCTATCTAGTTGG + Intronic
1143177100 17:4962020-4962042 TCAAGAGCTCCCAGTTTAGTGGG + Intronic
1147915015 17:43880820-43880842 TCATGAGCTGCTCATTTATGAGG - Exonic
1148202509 17:45758864-45758886 ACATCAGCTCCCTATTTATTAGG + Intergenic
1150860948 17:68799917-68799939 TCATTAGGTCCTTATTTAAGTGG + Intergenic
1150969802 17:70015046-70015068 GTATGAGCTCCCTAGTTAGCTGG + Intergenic
1153492340 18:5662622-5662644 TCATGAGGCACCTATTCAGGTGG - Intergenic
1156229453 18:35139631-35139653 TCCTGAGCTCCCTCATTGGGAGG + Intronic
1157938715 18:51902183-51902205 TCCTGAGCTCCCTCTATAGTAGG + Intergenic
1167756809 19:51417837-51417859 TCCAGAGCTCCCTGTGTAGGAGG + Intergenic
931177172 2:59865703-59865725 TCATGTGCTTCCTTTTTAGGTGG - Intergenic
933070252 2:77848258-77848280 TTATGAGCGTCCTATTTAGGTGG + Intergenic
935378072 2:102420993-102421015 TCAGGAGCTCCCAATCTAGTGGG + Intronic
942267900 2:174246790-174246812 CCATCACCTCCCTTTTTAGGGGG + Exonic
1168829848 20:839923-839945 TCATGAACTCCTTTTTAAGGAGG - Intronic
1172168082 20:32911114-32911136 TCAACAGTTCCCTACTTAGGGGG + Intronic
1176235793 20:64052904-64052926 TCAGGAGCTCTGTATTTAGTGGG + Intronic
1182062052 22:27405363-27405385 ACATGAGCTCACTGTTTAGTGGG - Intergenic
950968617 3:17164475-17164497 TCATGAGCTCCCAGTTATGGAGG - Intronic
951374486 3:21896590-21896612 AAAAGAGCTTCCTATTTAGGAGG + Intronic
952531749 3:34269637-34269659 TCAAGAGCTCGCTATGTGGGTGG + Intergenic
952713959 3:36459579-36459601 TAATGAACTCCTCATTTAGGAGG + Intronic
954963057 3:54582950-54582972 TGATAAGCTTCATATTTAGGAGG + Intronic
958463570 3:94429277-94429299 TAAGCAGCCCCCTATTTAGGAGG - Intergenic
959739705 3:109703264-109703286 TCATGACCTCACTCTTTAGTAGG + Intergenic
969352309 4:6604789-6604811 TCAGGAGCTCCCAGTTCAGGAGG + Intronic
971142285 4:23937276-23937298 TAATCAGCTCCCTATGTTGGTGG - Intergenic
971435895 4:26623065-26623087 TGTTTAGCTCCCTATTTTGGGGG + Intronic
975485477 4:74930755-74930777 TCATGTGTTCCCTATTTATGGGG + Intergenic
976950514 4:90823643-90823665 CCGTGAGCTCTCTATTTTGGGGG + Intronic
981526316 4:145709769-145709791 TCATGAGCTCCCTATTTAGGAGG + Intronic
982331794 4:154189089-154189111 TCATGTGCTCCCTAGTGAAGAGG - Intergenic
985346986 4:189016563-189016585 TTATGAGCTCACAAATTAGGTGG - Intergenic
985673915 5:1220573-1220595 TCACGTGCTCCACATTTAGGTGG - Intronic
987254196 5:16132424-16132446 TCATGAGGTCCATGTTAAGGAGG - Intronic
989021162 5:37011072-37011094 GCATGAGCTACCTATTAGGGAGG - Intronic
990299151 5:54433400-54433422 TCATTGGCTCCTTATGTAGGCGG - Intergenic
992491464 5:77248339-77248361 TCAGGAGCTTCCTATTTGGATGG + Intronic
992887779 5:81176205-81176227 CAAGGAGCTCCCCATTTAGGTGG - Intronic
994847451 5:105008026-105008048 TCATGATTTCCATATTTATGTGG - Intergenic
995833258 5:116376578-116376600 TCATGTGCTCACTATTAAGATGG + Intronic
998417687 5:141957614-141957636 TCAGGCGCTCCCCATTCAGGTGG - Exonic
1007557299 6:42777070-42777092 TGAGGAGCTCCCTATCCAGGAGG + Intronic
1009030810 6:58056171-58056193 TCATGAGCCCCTCATGTAGGGGG + Intergenic
1009206666 6:60810632-60810654 TCATGAGCCCCTCATGTAGGGGG + Intergenic
1015342256 6:132114536-132114558 TAATTAGCTCCCAATTTAGACGG + Intergenic
1018669865 6:166168966-166168988 TCCTGGGCTCCCGTTTTAGGAGG - Intergenic
1021328924 7:19310550-19310572 GCATGAGATCTCTATTGAGGAGG + Intergenic
1029540864 7:101181101-101181123 TCTTGAGCTCACTTTATAGGTGG - Intergenic
1039451761 8:37680560-37680582 CCATGGCCTCCCTATTTGGGAGG - Intergenic
1039789602 8:40864462-40864484 TCAGGTCCTCCCTATGTAGGTGG + Intronic
1042453076 8:68972393-68972415 TCATCAGCTCACATTTTAGGAGG - Intergenic
1043174329 8:77004913-77004935 CCATGAGCTCCTGATTTAGAAGG - Intergenic
1043593579 8:81858323-81858345 TCATGAGGTCCATATTCTGGTGG + Intergenic
1043677992 8:82984865-82984887 TCAAGAGCTTCCTATCAAGGTGG + Intergenic
1050042826 9:1513885-1513907 TCATGAGCTTCCTGTCCAGGAGG + Intergenic
1051888799 9:21922860-21922882 TCATGAGCCTCCTGTCTAGGAGG - Intronic
1057174678 9:92987520-92987542 TCATGAGCCTCCTGTCTAGGAGG + Intronic
1059897465 9:118883078-118883100 TCATGAGCTCCCTGGTATGGGGG - Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1188830491 X:34890818-34890840 TCATTAGCTCCCCATTTCGTAGG + Intergenic
1188917399 X:35929517-35929539 TGCTGAACTCCCTTTTTAGGAGG + Intronic
1189090988 X:38082556-38082578 TTATGAGCTTCCAATTTAGCAGG + Intronic
1190405370 X:50081430-50081452 TCATGTTCCCCCTTTTTAGGGGG - Intronic
1194558591 X:95393491-95393513 TCATGAGCTCCTTATTCATCAGG - Intergenic
1195220331 X:102740140-102740162 TCATAAGCCTCCTATCTAGGAGG + Intronic
1199674918 X:150180568-150180590 TCATGAACTTCATGTTTAGGTGG + Intergenic