ID: 981526963

View in Genome Browser
Species Human (GRCh38)
Location 4:145716224-145716246
Sequence GTCCCAGGTCACCATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981526963_981526966 -2 Left 981526963 4:145716224-145716246 CCTTTCTCATGGTGACCTGGGAC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 981526966 4:145716245-145716267 ACACAGACTTCCTTCCTCTTGGG 0: 1
1: 0
2: 15
3: 40
4: 485
981526963_981526965 -3 Left 981526963 4:145716224-145716246 CCTTTCTCATGGTGACCTGGGAC 0: 1
1: 0
2: 0
3: 19
4: 195
Right 981526965 4:145716244-145716266 GACACAGACTTCCTTCCTCTTGG 0: 1
1: 0
2: 3
3: 48
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981526963 Original CRISPR GTCCCAGGTCACCATGAGAA AGG (reversed) Intronic
900595953 1:3480280-3480302 GTGCCCGGTGACCATGAGCAAGG + Intronic
902277183 1:15348358-15348380 GTTTCCAGTCACCATGAGAAGGG - Intronic
902693694 1:18126434-18126456 GTCCCAGGTCATCAGCAGGAGGG + Intronic
902801788 1:18835079-18835101 GTCCTAGGTCATGAAGAGAAGGG - Intergenic
902902880 1:19532328-19532350 GTCCGAAGTCTCCATGAGGAAGG - Intergenic
902955512 1:19922203-19922225 GCCCAAGGTCACCATCAGGAGGG + Intronic
903056227 1:20638044-20638066 GTACCAGTGCACCAGGAGAAGGG + Exonic
903697938 1:25222774-25222796 GTCACAGGCCGCCATGAGGAGGG + Exonic
903943308 1:26946308-26946330 GTCCCGGGGCATCAGGAGAAAGG + Exonic
905183441 1:36179923-36179945 CTCCCAGCACACCAGGAGAATGG + Exonic
909972299 1:82005169-82005191 CTCCCAGTTCACACTGAGAATGG + Intergenic
910086447 1:83408953-83408975 ATCCCAGGTCAGCATGAGTATGG - Intergenic
910450794 1:87342696-87342718 TGCCCAGCTCACCATGAGCACGG + Intronic
910831308 1:91464864-91464886 AAGCCAGGTCACCATGAGGAAGG - Intergenic
911080241 1:93921683-93921705 GGCCCAGGCAACCATGAGGAAGG + Intergenic
913496221 1:119430543-119430565 GTGCCAGGTAACCATGACACAGG - Intergenic
914503079 1:148264752-148264774 GGCCCAGGTCGCCCTGAGAAGGG + Intergenic
915593181 1:156882016-156882038 GAGCCAGGTGACCATGGGAATGG - Intergenic
916314958 1:163438753-163438775 GTCCCATGTCAACAAGGGAAGGG - Intergenic
917217427 1:172692373-172692395 AGCCCAGGTCCCCTTGAGAAAGG - Intergenic
917480152 1:175404759-175404781 GTCCTAGGTTTCCATGAGCATGG - Intronic
918094390 1:181322541-181322563 TTTCCAGGTTACAATGAGAAAGG - Intergenic
918168189 1:181970516-181970538 GCCCCAGGACACTATGAGGATGG + Intergenic
918513436 1:185336496-185336518 GTGCCTGGTCAAAATGAGAAAGG - Intergenic
919334091 1:196209760-196209782 GGCCCAGGTCACCTTGAGGAAGG + Intergenic
920276048 1:204805159-204805181 GTACCAGCTTAACATGAGAAGGG - Intergenic
921091381 1:211847147-211847169 GTCCAAGGTGACCCTGAGAGTGG - Intergenic
921762093 1:218926891-218926913 GTCTCAGGTCACCTGGAAAAAGG + Intergenic
922810383 1:228412126-228412148 TTCACAGGTCACCATGGGACTGG + Intronic
924074793 1:240322747-240322769 GTTCCGTGTCACCATGAGAGAGG + Intronic
1063033236 10:2257247-2257269 TTCCTAGGTTACCATGAGCATGG - Intergenic
1065925021 10:30427685-30427707 GTCCCCGGTAACCCTGGGAAGGG - Intergenic
1068439733 10:57036422-57036444 GTACCAAGTCACAATTAGAAAGG - Intergenic
1069646565 10:70002831-70002853 TTCCAAGGTGACCATGAGCATGG + Intergenic
1077470043 11:2753393-2753415 GTCCCTGATCCCCCTGAGAAAGG + Intronic
1080968068 11:37237134-37237156 GTCCAGGGTCAACATGTGAATGG + Intergenic
1082958539 11:58897323-58897345 TTGCCATGCCACCATGAGAAGGG + Intronic
1083157947 11:60836933-60836955 ACCCCAGGTCACCATGGGGAGGG - Intergenic
1083710467 11:64545319-64545341 GTCCCAGAGCAGCATGGGAAAGG - Intergenic
1084940527 11:72610323-72610345 GCCACAGGTCACCAGGAGAGAGG + Intronic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1090205758 11:124883303-124883325 TTCATAGGTCACTATGAGAATGG + Intergenic
1090644193 11:128754331-128754353 GTCATAGGTCATCATCAGAAAGG + Intronic
1091277586 11:134362816-134362838 GGACCTGGTCACCATGAGATGGG - Intronic
1091718752 12:2797131-2797153 CTCCCAGGTCATCAAGAGAGAGG + Exonic
1096012978 12:48237414-48237436 TTCACAGGTCACCATGGTAACGG - Intergenic
1097788198 12:63784259-63784281 GTACCAGGGTACAATGAGAATGG + Intronic
1101148123 12:101860949-101860971 GTCAGTGGTCACCATGTGAATGG - Intergenic
1101454190 12:104812757-104812779 ATACCAGGTCTCCATGATAAAGG + Intronic
1101863510 12:108501934-108501956 GTCCCAGGTTATCAGGAGGATGG + Intergenic
1105247831 13:18668380-18668402 GACCCAAGTCATCATGAAAAAGG + Intergenic
1105517078 13:21100395-21100417 GAGCCAGGTCACCACCAGAAGGG - Intergenic
1107020756 13:35748340-35748362 TTCACAGGTCACCATGCTAATGG - Intergenic
1109351974 13:61194348-61194370 GTTCCAGGTCCCCATGATTATGG - Intergenic
1109639056 13:65162965-65162987 GACCAAGGTCACCTGGAGAACGG + Intergenic
1114672503 14:24418887-24418909 CTCCCAGTTCACCATGAAAAGGG + Exonic
1114922480 14:27350551-27350573 GTCCCAGGTCACAAACACAAAGG + Intergenic
1116158588 14:41238153-41238175 ATCCCAGGTCCACTTGAGAAAGG - Intergenic
1116586934 14:46717783-46717805 GTCACATTTCACCATGAGAGCGG + Intergenic
1119819127 14:77598817-77598839 GTCCCAGGTCCTCAGGAGATAGG + Intronic
1125960305 15:43824490-43824512 GTCCCAGTTCGCAATGAGAAAGG - Exonic
1126420692 15:48469301-48469323 GTCCCAGGAAACCCTCAGAAGGG + Intronic
1128123220 15:65170184-65170206 GTCCCCGGTTACCATTAGTAGGG - Intronic
1129350011 15:74950500-74950522 CTCGCAGGTCTCCAAGAGAATGG - Intergenic
1131174754 15:90202394-90202416 CTCCCAGGTCACTCTGAGGAGGG - Intronic
1131270973 15:90947520-90947542 TTCCCAGGCCACACTGAGAATGG - Intronic
1132753042 16:1467630-1467652 GACCCATTTCACCATGAGGAAGG + Intronic
1134863009 16:17577754-17577776 GACCCAGGTCTCCTGGAGAAGGG - Intergenic
1136776896 16:32876755-32876777 GTCCCGGGACACAATGAGAGGGG - Intergenic
1136893721 16:33984758-33984780 GTCCCGGGACACAATGAGAGGGG + Intergenic
1139203647 16:65004745-65004767 TTCCATGGGCACCATGAGAAGGG - Exonic
1140145966 16:72309218-72309240 TTCACAGGTCACCATGGTAATGG + Intergenic
1141442181 16:84036715-84036737 GTCCCCGATCACCCTGAGGAAGG + Exonic
1143538916 17:7558175-7558197 GTCCGAGGCCACCAAGAGGAAGG - Intronic
1143927284 17:10383105-10383127 GTCCCAGGGCATCATGGGAAGGG + Intergenic
1144484703 17:15655176-15655198 GTACCAGGTCACTCTGAAAAAGG - Intronic
1150109089 17:62482307-62482329 CACCCAGGTTACCATGAGACAGG - Intronic
1152375436 17:79916265-79916287 GTCACAGGTCACCTTGGGCAGGG + Intergenic
1152664485 17:81559377-81559399 CTCCCAGGTCTCCATGAGTACGG - Exonic
1153341914 18:3984244-3984266 TTCTTAGGTCACCATGAGAAGGG - Intronic
1154441018 18:14390754-14390776 GACCCAAGTCATCATGAAAAAGG - Intergenic
1155907709 18:31472290-31472312 GTCACAGGTCAACAGCAGAAGGG - Exonic
1157334568 18:46728619-46728641 AGCCCAGGTCACCAAGAGACTGG + Intronic
1157874387 18:51258887-51258909 GTCCCGGGTCATGATGAGACAGG - Intergenic
1158493086 18:57928210-57928232 GTCCCAGGTCCCAGTGAGTAGGG - Intergenic
1160425006 18:78773492-78773514 GTCCCAGGGCACCGTCAGGAGGG - Intergenic
1160900609 19:1426185-1426207 GTCCCAGGTCACCCAGAGGGAGG - Intronic
1161531947 19:4795009-4795031 GACCCAAGTCATCATGAAAAAGG + Exonic
1162953402 19:14085255-14085277 GTCCCAGGTCCCCATGGGTAAGG - Intronic
1164685174 19:30161780-30161802 TTCACAGGTCACCATGGCAATGG + Intergenic
1165732043 19:38152204-38152226 GTCCCAAGTCACCATGTGTCAGG + Intronic
925841595 2:7997123-7997145 ATCCCATCACACCATGAGAATGG + Intergenic
926329153 2:11810549-11810571 GTCACAAGCCACCTTGAGAAAGG - Intronic
926638921 2:15214162-15214184 GTCCAAGGTCACCCTTAAAATGG - Intronic
926749216 2:16185264-16185286 GACGCAGGTCTCCATGAGGAGGG + Intergenic
926906602 2:17811586-17811608 GTCCCAGGTCACAATAACAGAGG + Intergenic
927443658 2:23138970-23138992 ATCCCTGGTCACCTTCAGAACGG + Intergenic
928169192 2:28992445-28992467 GTCCCAGGACACCAGCAGTATGG - Intronic
929726994 2:44440047-44440069 GGCGCAGGTCAGAATGAGAAAGG + Intronic
931798330 2:65733508-65733530 GTCCCAAATGACCATGTGAAAGG + Intergenic
932003319 2:67904802-67904824 GGCCCAGGTCTCCATGATCAGGG + Intergenic
932876082 2:75454106-75454128 ATCACAGGACACGATGAGAATGG + Intergenic
933573037 2:84036005-84036027 GTGCCTGGTCCCCATGAAAAGGG + Intergenic
935621533 2:105134525-105134547 GTTCCAGCTCCCCAGGAGAATGG - Intergenic
935922052 2:108026417-108026439 TTCCCAGGTCTCCATGAGCAAGG + Intergenic
938953918 2:136281617-136281639 GTCCCATCTCCCCATTAGAAGGG - Intergenic
940322408 2:152390762-152390784 ATCCCAGGGCATCAGGAGAAAGG + Intronic
941873681 2:170411757-170411779 GCCCAAGGTCACCAGGAGACAGG + Intronic
942094258 2:172522944-172522966 GTCCCAGGTCATGATGACAGTGG - Intergenic
942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG + Intronic
946049543 2:216850431-216850453 GTTCCAGCTAACCTTGAGAAGGG + Intergenic
946277428 2:218642182-218642204 GTACTAGATCACCATGTGAAAGG - Exonic
1172032391 20:31991161-31991183 GGCCCGGGTCAGCATGAGAGAGG - Intronic
1176051004 20:63119762-63119784 CTCCCCGGCCACCATGAGGATGG + Intergenic
1176059672 20:63167042-63167064 GGCCCAGGTCACCATGCACAGGG + Intergenic
1177626758 21:23672228-23672250 GTCCAAGGCCACCTTGAGTACGG - Intergenic
1178095967 21:29216332-29216354 CTCCTAGGTCATCAAGAGAATGG + Intronic
1178451122 21:32701260-32701282 TTACCAGCTCACAATGAGAAAGG + Intronic
1181435847 22:22910405-22910427 GTCCCATCTCAGCTTGAGAAGGG + Intergenic
1182695737 22:32198372-32198394 GTCCCATCTCAGCTTGAGAAGGG + Intronic
1184669472 22:46005301-46005323 TTCCAATGTCACCATCAGAAGGG - Intergenic
1184836897 22:47029256-47029278 GTCCCTGGGCCCCATGGGAAGGG - Intronic
1184925831 22:47636730-47636752 GTCCCAGGTCAGCTTGAGTGTGG + Intergenic
1185046807 22:48532688-48532710 CTTCCAGGTCACCATGAAAGGGG + Intronic
949399811 3:3654207-3654229 ATCCTAGGCCACCATGGGAAGGG + Intergenic
950799582 3:15539320-15539342 TTCCCATGTCCCCATGGGAAGGG + Intergenic
952510094 3:34044302-34044324 TTGCCAGTTCACCAAGAGAAGGG - Intergenic
954408706 3:50359656-50359678 GTCCCAGGAGGCCATGAGCACGG + Intronic
954490626 3:50901339-50901361 GTCCCAGGTCAACTTCAGACTGG + Intronic
954827536 3:53387317-53387339 GTGCCAGGTCACCAAGGGATGGG + Intergenic
954927830 3:54252797-54252819 GACCAAGGGCACCATGAGAGGGG + Intronic
962649497 3:137474219-137474241 GGCTCAGGGCTCCATGAGAAAGG - Intergenic
966194289 3:177298036-177298058 GTCCCATGGCACCACGGGAAAGG - Intergenic
966660683 3:182411218-182411240 GGCCCAGCTCTCCATGAGGATGG - Intergenic
968709051 4:2099324-2099346 GACCCAGGTCAGCATCAGCAGGG + Intronic
969109710 4:4836382-4836404 ATTCCAGGTCACCATGACCATGG + Intergenic
969556917 4:7918189-7918211 GGCCCAGGTCACCAGGAAACAGG + Intronic
969556927 4:7918234-7918256 GGCCCAGGTCACCAGGAAACAGG + Intronic
969556936 4:7918276-7918298 GGCCCAGGTCACCAGGAAACAGG + Intronic
969556992 4:7918527-7918549 GGCCCAGGTCACCAAGAAACAGG + Intronic
969557010 4:7918611-7918633 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557029 4:7918694-7918716 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557045 4:7918777-7918799 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557062 4:7918854-7918876 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557072 4:7918896-7918918 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557082 4:7918938-7918960 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557091 4:7918980-7919002 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557100 4:7919021-7919043 GGCCCAGGTCACCAGGAAACAGG + Intronic
969557109 4:7919063-7919085 GGCCCAGGTCACCAAGAAACAGG + Intronic
969613856 4:8241241-8241263 GTGCCAGGTCACCATGAGCCTGG + Intronic
969841560 4:9886780-9886802 GTCCAAGGTCAGACTGAGAAGGG - Intronic
975573335 4:75839537-75839559 TTCGCAGGTCACCATGGTAATGG + Intergenic
980029345 4:127808673-127808695 GTCCCAGGTCTCTCTGAGGATGG - Intronic
981081996 4:140645077-140645099 GCCCCAGGTCACCAGGAGGTTGG + Intronic
981281255 4:142962166-142962188 GTCCCAGGTCAGCTTGTGGAGGG + Intergenic
981526963 4:145716224-145716246 GTCCCAGGTCACCATGAGAAAGG - Intronic
982386643 4:154812323-154812345 GTCTCAGGTCAACATTACAATGG - Intronic
984472031 4:180188681-180188703 GTCAAAGGACACCATGAAAAAGG + Intergenic
985854141 5:2411981-2412003 GCCCCTGGTTTCCATGAGAATGG - Intergenic
992766351 5:80004373-80004395 GTTCCAGGTCACCAACAGATGGG - Intronic
994131193 5:96230074-96230096 GTCACTTGTCACCATGAGAATGG - Intergenic
997369402 5:133348514-133348536 GTCCCAGGATGCCATGGGAAAGG + Intronic
998007801 5:138668646-138668668 GTCCCAGAACACCACGAGCAAGG - Intronic
998952228 5:147403977-147403999 GCCCTAGGTCACCCTAAGAATGG + Intronic
999584698 5:153077287-153077309 GTCAGAGGTCCCCATGAGCAGGG + Intergenic
1002431217 5:179205180-179205202 GACCCTGGGCACCAGGAGAAAGG + Intronic
1002790395 6:433422-433444 GCCCCAGGGCAGCATGAGGAGGG + Intergenic
1003028082 6:2576514-2576536 GTCCAATGACACTATGAGAATGG + Intergenic
1003039468 6:2673816-2673838 GGCCACGGTCACCATGGGAATGG + Intronic
1005871117 6:29975020-29975042 GACCCAGGGGGCCATGAGAAAGG + Intergenic
1008535392 6:52503255-52503277 TTCCCAGGTTACCATGAAAATGG - Exonic
1010816068 6:80359396-80359418 GTCCCAGTTCACCACGGGAAGGG - Intergenic
1014736520 6:125100701-125100723 GTCCCTGGTTAACAAGAGAAGGG - Intergenic
1015274048 6:131366323-131366345 TACCCAGGTCCCCATGGGAATGG + Intergenic
1016314684 6:142772470-142772492 GTTCCGTGTGACCATGAGAAAGG + Exonic
1016984570 6:149885349-149885371 GTCCCTGGCCAACAGGAGAAAGG - Intronic
1017521624 6:155207784-155207806 GTTTCAGGTAAGCATGAGAAAGG - Intronic
1018095222 6:160381038-160381060 GTGCCAGGACACAATGAGAAAGG + Intronic
1019148601 6:169989267-169989289 GGCCCTCGACACCATGAGAAAGG - Intergenic
1019375913 7:691842-691864 CTCTCCGGTCACCATGACAACGG + Intronic
1020113417 7:5461063-5461085 GCACCAGGACACCAGGAGAAAGG - Intronic
1021877315 7:25060691-25060713 GGCTCAGGCCACCAGGAGAATGG + Intergenic
1021989567 7:26128985-26129007 GCCCCAGATCACCATGGGAGGGG + Intergenic
1023517516 7:41016780-41016802 GTCACAGGTGAGCATTAGAATGG - Intergenic
1027303331 7:76865440-76865462 ATCCCAGGTCAGCATGAGTATGG - Intergenic
1028338035 7:89681946-89681968 CTCTCAGGGCACCATGGGAAAGG - Intergenic
1028980497 7:96962645-96962667 ATCCCTGGCCACCATCAGAAAGG + Intergenic
1029129218 7:98317563-98317585 GGCCCTGGTCAGCATGAGGATGG - Intronic
1031951618 7:127898483-127898505 CTCCCAAGTAACCAGGAGAAAGG + Intronic
1032854050 7:135819443-135819465 GTTCCAGCTCCCCATGAGCAAGG + Intergenic
1033230258 7:139591836-139591858 TTCCCACGTCTCCATGAGCATGG + Intronic
1035242850 7:157543457-157543479 GTCCCAGGACAGCCTGAGAAGGG - Intronic
1038061001 8:23912604-23912626 TTCCCAGCTCTCCATGAGACTGG - Intergenic
1040617212 8:49048512-49048534 GACCCAGGTCGGCATGTGAATGG + Intergenic
1040829878 8:51664711-51664733 GTCCCAGGTCACTATATAAATGG - Intronic
1041410552 8:57549631-57549653 GAGCAAGGTCACCATAAGAAGGG - Intergenic
1047956897 8:129983575-129983597 GTGCCAGGTCACCCTGAGTGTGG + Intronic
1049509473 8:143020119-143020141 GCCCCAGGTCTCCATGTGAGGGG + Intronic
1049517582 8:143069568-143069590 GTCCCAGTTCACCTGGAGCACGG - Intergenic
1049783731 8:144440637-144440659 GTCCATGGCCACCCTGAGAACGG + Intronic
1052834053 9:33237292-33237314 GTCCCAGGTTACAGTGAGGAAGG - Intronic
1052903607 9:33816447-33816469 GCCCCAAATCACAATGAGAAGGG + Intergenic
1056193058 9:84203857-84203879 GTCCCAGGTCTTCATCAGGATGG + Intergenic
1056788990 9:89613230-89613252 TTCCAAGGTCACCATGGGATTGG + Intergenic
1057904562 9:98974147-98974169 GCCTCAGTTCAACATGAGAAAGG + Intronic
1058259811 9:102814639-102814661 GTCCCAGGTCGACTTGAGACTGG - Intergenic
1058360624 9:104142555-104142577 GTCCAAGGTCACCTGGAGAACGG - Intergenic
1059440041 9:114301594-114301616 GTCCCAGGTCTGCTTGAGGAGGG + Intronic
1062051296 9:134448428-134448450 GTCCCTGGGCACCCAGAGAAAGG - Intergenic
1186088436 X:6016951-6016973 CTCCCAGGTCCCCAGGAGATAGG - Intronic
1187495316 X:19790195-19790217 AGCCCAGGTAACCATGTGAAGGG - Intronic
1189290115 X:39878782-39878804 GTCCCAGGTCACCAGGTCACAGG - Intergenic
1197488803 X:127090171-127090193 GTGCCAGGTCAGCAGCAGAATGG - Intergenic
1199634684 X:149804158-149804180 TTCCAGGGTCACCATCAGAACGG + Intergenic
1199760232 X:150899061-150899083 CTCCCGGGTGACCTTGAGAAGGG + Intergenic