ID: 981528524

View in Genome Browser
Species Human (GRCh38)
Location 4:145731472-145731494
Sequence ATTAATATGGGGCACATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981528524 Original CRISPR ATTAATATGGGGCACATATT TGG Intronic
904015301 1:27415329-27415351 AGTTATCTGGGGCACATATAAGG + Intronic
905267128 1:36761990-36762012 AAAAGTATGTGGCACATATTAGG - Intergenic
906843272 1:49162317-49162339 AGAAATATAGGGCACATGTTTGG - Intronic
908134800 1:61120017-61120039 ATCTATATGGGTAACATATTTGG + Intronic
908530870 1:65032800-65032822 AGTGTTATGGGGCACCTATTAGG + Intergenic
912085707 1:106000593-106000615 ATGAATATGGGGCAGACATCAGG - Intergenic
912657054 1:111496279-111496301 ATTAACTGGGGGCACACATTTGG - Intronic
913691468 1:121283592-121283614 ATGAATTTGGGGCACACATAAGG + Intronic
914146077 1:144996390-144996412 ATGAATTTGGGGCACACATAAGG - Intronic
914892692 1:151641027-151641049 ATTAAAAAGGGACAAATATTTGG - Intronic
916080008 1:161226484-161226506 ACTAAAATGGGGAACACATTGGG + Exonic
919544922 1:198903579-198903601 ATTAACATTGGGCAGTTATTCGG - Intergenic
920478794 1:206302069-206302091 ATGAATTTGGGGCACACATAAGG + Intronic
922018002 1:221672010-221672032 TTTATGATGGGGCACATAGTGGG - Intergenic
922641993 1:227243368-227243390 ATTAATAAGTGGCACACATAGGG + Intronic
1062770568 10:97170-97192 ATGAAGATGAGGAACATATTGGG - Intergenic
1064277441 10:13919348-13919370 AATAAAATGGGGCACGTAATTGG - Intronic
1064619908 10:17204547-17204569 ATAAAGATGTGGCACATATGAGG - Intergenic
1066648221 10:37632243-37632265 ATTTAGATGGGGCCCATGTTTGG - Intergenic
1067836161 10:49643185-49643207 ATTGATATTTGGCACATAGTAGG + Intronic
1068364192 10:56023886-56023908 AATAATAAAGGGCACATTTTTGG - Intergenic
1074442466 10:113490612-113490634 AGTAATTTGGGGCACTTCTTAGG - Intergenic
1077949331 11:6938760-6938782 ATTAATATGGGGCTCTTTCTTGG + Intronic
1078324813 11:10370824-10370846 ACTAATACGGGGCAGGTATTTGG + Intronic
1079354517 11:19719029-19719051 AATAATATGGGACCCAGATTTGG - Intronic
1079661838 11:23047627-23047649 ATCCATTTGGGGCTCATATTTGG + Intergenic
1086031733 11:82367022-82367044 ATTATTATGAGGCCCATTTTAGG + Intergenic
1086083732 11:82933441-82933463 GTTAAAATGGGGAACATCTTTGG + Exonic
1086125337 11:83343786-83343808 TTTAATATTGGGAACAGATTGGG + Intergenic
1086503200 11:87474398-87474420 CCCAATATGAGGCACATATTAGG + Intergenic
1086679339 11:89650241-89650263 ATAAAAATTGAGCACATATTAGG - Intergenic
1087942845 11:104121278-104121300 AATATTAAGGGGTACATATTTGG + Intronic
1087942863 11:104121825-104121847 ATTAATATTTGGTACATATTTGG - Intronic
1089124319 11:116165711-116165733 AATAGTATGTGGCACATAGTAGG + Intergenic
1092587381 12:9913054-9913076 ATTAATTTGGGGCACATATTTGG - Intronic
1093395717 12:18679652-18679674 ATTAATATTAGGCACACATTAGG + Intergenic
1093889903 12:24507538-24507560 TTTAATATGTGGTACTTATTTGG + Intergenic
1094684977 12:32702353-32702375 ATTAACATAGGATACATATTTGG - Intronic
1095347988 12:41175065-41175087 ATTAATGTGGGTCAGATTTTAGG + Intergenic
1097606362 12:61759355-61759377 AGTAATATGGGCCACTTATGAGG + Intronic
1100679611 12:96905115-96905137 ATGAAAATGGAGCATATATTGGG - Intergenic
1104243978 12:127019180-127019202 ATATTTATGGTGCACATATTTGG - Intergenic
1104356641 12:128092628-128092650 ATTATTCTGGGGCCCATATTTGG - Intergenic
1107627728 13:42307110-42307132 ATGAGAATGTGGCACATATTAGG + Intronic
1108133339 13:47327705-47327727 ATTAATATGTGGCCCCTCTTGGG - Intergenic
1108943248 13:55985177-55985199 ATCATTATGGAGCACATTTTTGG + Intergenic
1109166753 13:59044880-59044902 GTTCATTTGGGGCAGATATTTGG + Intergenic
1109556102 13:63977434-63977456 ATTATTATGGGGCATTCATTGGG - Intergenic
1110629752 13:77694800-77694822 ATTAATGTAGTGCTCATATTAGG + Intergenic
1111203250 13:84967549-84967571 ACTAAAATGGGGCAGATATTTGG + Intergenic
1112120667 13:96407491-96407513 CCTAATATTGGACACATATTAGG + Intronic
1114315616 14:21507237-21507259 AATAATATGGGCAAAATATTGGG - Intronic
1116425658 14:44787485-44787507 AATAATATCTGGCACATAGTAGG - Intergenic
1118480843 14:66163719-66163741 ATTTATATGGGGCTCAAATCAGG - Intergenic
1121076647 14:91074551-91074573 AATTATATGGGGCAGAAATTGGG - Intronic
1124161721 15:27276245-27276267 ATGGATTTGGGGAACATATTTGG + Intronic
1125455309 15:39852824-39852846 AGTAATATTTGGCACATAATAGG + Intronic
1125653774 15:41339141-41339163 TTCATTATGGGCCACATATTAGG + Intronic
1127243107 15:57140645-57140667 ATTTATTTGGGACACATAGTGGG + Intronic
1134851127 16:17479880-17479902 ACTAATATGGGGCTCATTCTTGG - Intergenic
1134901454 16:17941670-17941692 AATAATATGGGGCATTTGTTTGG + Intergenic
1136534461 16:30891628-30891650 AATAATATGGGACACATAGTAGG - Intronic
1136617995 16:31410458-31410480 ATGAAGGTGGGGCTCATATTTGG - Exonic
1137283142 16:46995022-46995044 ATTAATAAGGAACAAATATTTGG + Intergenic
1139785178 16:69386521-69386543 TTTAATAAGGTGCACATATTTGG - Intronic
1144458462 17:15437913-15437935 ATCAATGTGGGGCGCTTATTCGG - Exonic
1146737020 17:35247166-35247188 ATTAGTTTGGGGAACATATTTGG - Intronic
1148520266 17:48267542-48267564 ATTAATATAGGGCAATAATTTGG - Intronic
1149341773 17:55694199-55694221 CTTAATTTGGAGCACATTTTAGG + Intergenic
1150961079 17:69912945-69912967 AATGATTTGGGGCAGATATTTGG - Intergenic
1153209645 18:2746846-2746868 ATTAATATTGGGCACATCAAAGG - Intronic
1155912947 18:31525737-31525759 ATTAGTATGAGGCTCACATTTGG + Intronic
1156295298 18:35784034-35784056 ATTGTTCTGGAGCACATATTGGG - Intergenic
1160164968 18:76502806-76502828 ACAAATATGTAGCACATATTAGG - Intergenic
1162002667 19:7757187-7757209 ATGAATATGGGGAACTTTTTGGG + Intergenic
1168270185 19:55245627-55245649 ATTGATCTGGGGCACATCTGAGG + Exonic
925083561 2:1090355-1090377 GTTAATCTGGGGCTCATATGTGG + Intronic
925967636 2:9080675-9080697 AGTAATATGCAGCACATAATTGG - Intergenic
926440970 2:12888409-12888431 ATCAAGATGTGGCACATTTTGGG - Intergenic
926841489 2:17085639-17085661 TTTAATATGTGACACATACTAGG - Intergenic
929767152 2:44854831-44854853 ACTTGTAGGGGGCACATATTTGG - Intergenic
929933103 2:46273864-46273886 TTTAATTTGGGGCTCACATTGGG - Intergenic
930287876 2:49456312-49456334 ATTAATATATGGCATATCTTAGG - Intergenic
930426495 2:51219384-51219406 TTGAATTTGGGGCACAGATTTGG - Intergenic
930973985 2:57431913-57431935 ATCAATATGTGGCTCATGTTAGG + Intergenic
931089955 2:58875196-58875218 ATTAATAAGGGACAAATACTTGG - Intergenic
931113064 2:59134302-59134324 ATAAAGATGGGGCACACACTAGG - Intergenic
933272840 2:80251740-80251762 ATTAATATGGGGCCCAAAGCAGG - Intronic
933388615 2:81643065-81643087 ATTAATAAGCGCAACATATTAGG + Intergenic
936799505 2:116250587-116250609 AATAATTTACGGCACATATTGGG + Intergenic
937799599 2:126066648-126066670 ATTAATATTTGGCACATTTCTGG - Intergenic
939390840 2:141567948-141567970 AATAATATCAGGCACAAATTTGG - Intronic
940335450 2:152522326-152522348 AATAATACTGGGCACATAGTAGG + Intronic
941090306 2:161167502-161167524 ATTAATATGGGGAATTTATTTGG + Intronic
942789362 2:179741216-179741238 AATAATATGGACAACATATTTGG - Intronic
943555417 2:189397049-189397071 ATGAATCTGGGGCACACATCTGG - Intergenic
944941865 2:204637119-204637141 ATTAATCTGGAGTACATTTTTGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945635288 2:212341642-212341664 ATTTTTATGGGACATATATTAGG - Intronic
1170089009 20:12569489-12569511 ATTGATTTGGGGAGCATATTTGG - Intergenic
1172674713 20:36660285-36660307 ATTAATCTGAAGCACATATAAGG + Intronic
1172922474 20:38496818-38496840 ATTAATTTTGGGGACCTATTAGG + Intronic
1173356015 20:42291249-42291271 ATTACTATGTGCCACACATTGGG + Intronic
1174870780 20:54179685-54179707 ATTAATATGTGTAAAATATTTGG + Intergenic
1177276967 21:18924513-18924535 CATATTATGGGACACATATTTGG - Intergenic
1177617231 21:23538553-23538575 CTTAATATGTGTCACATAGTAGG - Intergenic
1177904065 21:26953822-26953844 ATTATTTTGGGGAATATATTGGG - Intronic
1177947788 21:27493459-27493481 AATAAAATAGGGCACATATCTGG - Intergenic
1179073228 21:38092835-38092857 CTTAATATGTGGCATTTATTTGG - Intronic
1179288644 21:39999128-39999150 ATAAATATGGAACACATATATGG + Intergenic
1182133843 22:27881799-27881821 ATTAATTTGGAGGATATATTAGG + Intronic
950981903 3:17315934-17315956 ATTGATTTGGGGAACATATTTGG + Intronic
951459987 3:22940980-22941002 TTTTCTTTGGGGCACATATTTGG - Intergenic
951712515 3:25599299-25599321 ATCAATATGGGGCTTGTATTTGG - Intronic
951946369 3:28141293-28141315 TATAATATTTGGCACATATTAGG + Intergenic
953268040 3:41412337-41412359 AGTAATTTGGGGAAAATATTGGG - Intronic
953835528 3:46339756-46339778 ATGAAGATGGGGAACTTATTGGG - Intergenic
955288201 3:57665091-57665113 ATTAAAATACGGCACATATATGG + Intronic
956467597 3:69534898-69534920 CTTAAAATGTGGCACATAGTTGG + Intronic
957413271 3:79867714-79867736 AATAATATCTGGCACATATTGGG + Intergenic
958066242 3:88547140-88547162 CAGAATATGAGGCACATATTAGG + Intergenic
959447313 3:106456347-106456369 ATTCATTTGGGGACCATATTTGG - Intergenic
959473861 3:106785718-106785740 TTATATATGGGGCATATATTGGG - Intergenic
965176247 3:165337137-165337159 ACTAATATCTAGCACATATTAGG + Intergenic
965461799 3:168975010-168975032 ATGAATGTGGGGTACAGATTAGG - Intergenic
966550870 3:181202730-181202752 AAAAATATGGAGAACATATTTGG - Intergenic
968890419 4:3365909-3365931 AATAATGTCGGGCACATAGTAGG - Intronic
971292342 4:25355546-25355568 CTTAATATGGGACACTTGTTTGG + Intronic
971627112 4:28935712-28935734 TTTAAATTGGGGTACATATTTGG + Intergenic
972690388 4:41391629-41391651 ATTAATCTGGGGCATAGATTTGG - Intronic
972942472 4:44213750-44213772 ATCAATATGAGCCATATATTTGG + Intronic
975051223 4:69867192-69867214 AGAAACATGGGGAACATATTTGG + Intergenic
977061855 4:92269631-92269653 AATAATATCTGGCTCATATTCGG - Intergenic
977404206 4:96575481-96575503 ATTAATTGGGGAAACATATTTGG + Intergenic
977991845 4:103452618-103452640 AATAATTTGGGGCACATAGCAGG - Intergenic
979734068 4:124060774-124060796 GTTCATCTGGGACACATATTTGG - Intergenic
981528524 4:145731472-145731494 ATTAATATGGGGCACATATTTGG + Intronic
982697947 4:158624934-158624956 ATCAAAAAGAGGCACATATTGGG - Intronic
984862007 4:184249451-184249473 TTTAATTTGGGGTACATAGTAGG - Intergenic
985019522 4:185672778-185672800 TTTATAATGGAGCACATATTTGG + Intronic
986202948 5:5595754-5595776 ATTAATCTAGGGCTTATATTAGG - Intergenic
986818669 5:11441127-11441149 AATTATATGGGGATCATATTTGG + Intronic
987209672 5:15667785-15667807 AATAATATGGAGCACATCTCAGG - Intronic
988263655 5:28924571-28924593 ATTAATAAGGGACACATTTTTGG + Intergenic
988275851 5:29080297-29080319 ATTAATATGGGGTCCATTATTGG + Intergenic
989697784 5:44224252-44224274 AATGATATCGGGCACATAGTAGG - Intergenic
990809284 5:59704135-59704157 AACACTATGGAGCACATATTTGG + Intronic
991059362 5:62356545-62356567 ATTAAAATGAGGCATGTATTGGG + Intronic
991379153 5:66001016-66001038 ATTAATAAAGCACACATATTAGG + Intronic
994985312 5:106926019-106926041 AGTAATTTGGTGCAAATATTGGG - Intergenic
995156905 5:108925756-108925778 AATAATATAAGACACATATTTGG - Intronic
996682353 5:126241712-126241734 ATAAATATGAGGCCCAGATTAGG + Intergenic
998415983 5:141946264-141946286 AATAATAGGGACCACATATTAGG + Intronic
1000387896 5:160692907-160692929 ATTGATTTGCTGCACATATTGGG + Intronic
1000610579 5:163369171-163369193 ATTAATATGTGTCCCATCTTAGG - Intergenic
1001044249 5:168359375-168359397 ATTAATTTCAGACACATATTAGG - Intronic
1001228464 5:169965548-169965570 CTTAATATGTGGCAAACATTGGG - Intronic
1002418120 5:179131507-179131529 ATGAATGTGGGGCTCAGATTGGG + Intronic
1003919075 6:10815165-10815187 AATAATATTTGGCATATATTAGG - Intronic
1003984548 6:11422400-11422422 AATAATATGTTGAACATATTGGG - Intergenic
1004877730 6:19972595-19972617 ATTACTATAGAGCAGATATTTGG - Intergenic
1005024745 6:21451818-21451840 ATTACTATGTGGAACATTTTGGG - Intergenic
1006901197 6:37502951-37502973 ATAAATTTGGGGCAAATACTTGG + Intergenic
1008267161 6:49442384-49442406 AGTAATATCTGGCACATATTAGG - Intronic
1010476251 6:76292361-76292383 TTTAGGATGGGGCACATAGTGGG - Intergenic
1011327131 6:86161135-86161157 ATGATTATGGGGCATATTTTAGG + Intergenic
1011463441 6:87630487-87630509 ATTAACACCGGGCACATAATAGG - Intronic
1013203229 6:107922130-107922152 TTTACTATGTGGCACATAGTAGG - Intronic
1014430364 6:121363328-121363350 ATTTACATGGGGTAAATATTTGG - Intergenic
1014921797 6:127222272-127222294 ATTATTTTGTGGCACAAATTAGG - Intergenic
1015427910 6:133093603-133093625 GTTGGTATGGGGCACATAGTAGG - Intergenic
1015431442 6:133135189-133135211 AATAAAATTGGGCAGATATTAGG + Intergenic
1017188871 6:151630405-151630427 ATTAATATGAGGCCCTTAATAGG + Intergenic
1019833599 7:3358383-3358405 TTTAATGAGGGGCAAATATTTGG + Intronic
1020535768 7:9395900-9395922 TTTAAAATGGGGCAGTTATTTGG - Intergenic
1021915210 7:25424756-25424778 AAAAATATTGGGCACAAATTTGG + Intergenic
1022389033 7:29927626-29927648 ATACATATGGGGCACATATGGGG - Intronic
1023257395 7:38325577-38325599 AATAATATGGGGGAAATCTTGGG + Intergenic
1024515675 7:50252841-50252863 ATAAATATAAGGTACATATTAGG - Intergenic
1024696580 7:51863279-51863301 AGTATTATGGGGCACACTTTTGG - Intergenic
1026289846 7:68996734-68996756 ACTAATTTGGGGCAAAGATTGGG - Intergenic
1028925481 7:96353116-96353138 TTTAGCAAGGGGCACATATTTGG + Intergenic
1030532283 7:110726571-110726593 ATTAAAAAGGGGAACTTATTTGG + Intronic
1030957907 7:115878074-115878096 ATTACTGTCGGGCTCATATTTGG - Intergenic
1031829315 7:126607425-126607447 ATCACTTTGGGGGACATATTTGG + Intronic
1037017771 8:13929802-13929824 ATAAAAAAGGGGCACTTATTAGG + Intergenic
1040536236 8:48313435-48313457 ATTTTTATGGGGCACAGACTGGG + Intergenic
1042400414 8:68339030-68339052 ATAAAAATGGGCAACATATTTGG - Intronic
1042676728 8:71329667-71329689 TCAAATATGTGGCACATATTAGG + Intronic
1042869374 8:73383584-73383606 AATAATGTTGGGCACATATTAGG + Intergenic
1043014030 8:74915770-74915792 ATAAATATTGGGAAAATATTGGG + Intergenic
1044682285 8:94793883-94793905 ATTAAAATGTTGCACATTTTAGG - Intergenic
1045323015 8:101096087-101096109 ACCAATATTGGGCACATAGTAGG + Intergenic
1045822631 8:106358361-106358383 AGTCATTTGGGGCACATCTTTGG + Intronic
1047955235 8:129969753-129969775 ATAAATATGAGAAACATATTTGG + Intronic
1048412786 8:134192931-134192953 ATTAATACCTGGCACATAGTTGG + Intergenic
1051005832 9:12342425-12342447 ATAAACATGGGGCAGACATTTGG + Intergenic
1055377085 9:75660189-75660211 GTTCCTATGGGTCACATATTTGG - Intergenic
1058948388 9:109880105-109880127 TTTAATATGGACCAGATATTAGG + Intronic
1059530504 9:115031169-115031191 AATTATATGGGCCACATACTGGG + Intronic
1059680677 9:116582410-116582432 ATTAGTATGTGGCACATAATAGG - Intronic
1185853350 X:3509390-3509412 GTTTATATGGGGCACAGAATGGG - Intergenic
1185881475 X:3745148-3745170 ATTTCTTTGGGGTACATATTTGG + Intergenic
1187206193 X:17183981-17184003 AGTACTATGGGTAACATATTTGG - Intergenic
1188643199 X:32532611-32532633 ATTAATATGTAGCAAATACTTGG + Intronic
1193414555 X:81206096-81206118 ATTAATATGTGGAATATATAAGG - Intronic
1197113439 X:122803075-122803097 ATTAGTATTGTGTACATATTTGG + Intergenic
1197966263 X:132065509-132065531 ACTAATAGGGGACACAGATTTGG - Intergenic
1198557426 X:137809940-137809962 GTTAGTATTGAGCACATATTGGG - Intergenic
1201918180 Y:19205094-19205116 ATTTCTTTGGGGTACATATTTGG - Intergenic