ID: 981530910

View in Genome Browser
Species Human (GRCh38)
Location 4:145752945-145752967
Sequence AGTGAGAGCACAGCGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 37, 3: 107, 4: 325}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981530910_981530919 21 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530919 4:145752989-145753011 CGTGCCACGTGGCCGCTGCTGGG No data
981530910_981530924 28 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530924 4:145752996-145753018 CGTGGCCGCTGCTGGGGGCTGGG 0: 1
1: 1
2: 4
3: 54
4: 402
981530910_981530923 27 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530923 4:145752995-145753017 ACGTGGCCGCTGCTGGGGGCTGG 0: 1
1: 1
2: 4
3: 43
4: 483
981530910_981530921 23 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530921 4:145752991-145753013 TGCCACGTGGCCGCTGCTGGGGG 0: 1
1: 3
2: 20
3: 53
4: 232
981530910_981530925 29 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530925 4:145752997-145753019 GTGGCCGCTGCTGGGGGCTGGGG 0: 1
1: 3
2: 17
3: 96
4: 887
981530910_981530920 22 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530920 4:145752990-145753012 GTGCCACGTGGCCGCTGCTGGGG 0: 1
1: 5
2: 17
3: 45
4: 186
981530910_981530916 10 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530916 4:145752978-145753000 CACAGATCCTGCGTGCCACGTGG 0: 1
1: 0
2: 2
3: 9
4: 86
981530910_981530918 20 Left 981530910 4:145752945-145752967 CCCACAATCGCTGTGCTCTCACT 0: 1
1: 0
2: 37
3: 107
4: 325
Right 981530918 4:145752988-145753010 GCGTGCCACGTGGCCGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981530910 Original CRISPR AGTGAGAGCACAGCGATTGT GGG (reversed) Intronic
901423912 1:9169089-9169111 AGAGAGAGGACAGCGCTTGGTGG - Intergenic
901681041 1:10913007-10913029 AATGAGAGCTCAGGGAATGTGGG + Intergenic
901833263 1:11906962-11906984 AGTGAGAGAACAGGGGTAGTGGG + Intergenic
902921613 1:19669319-19669341 AGTGAGTGCTCACAGATTGTGGG - Intronic
903316883 1:22515042-22515064 AGTGAGAGGACAGGGCTTGGGGG + Intronic
904116969 1:28170038-28170060 AGTGAGAGCTCATTGAATGTTGG + Intronic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908175705 1:61553152-61553174 AGTGAGAGCACACTGATTGTGGG - Intergenic
909870362 1:80731131-80731153 AGGAAGAGCAAAGTGATTGTGGG + Intergenic
910328104 1:86034438-86034460 AGTTAAAGCACAGAGAGTGTAGG + Intronic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911012600 1:93297057-93297079 AGTAAGAGCGCAGTGATTTTGGG - Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912181764 1:107227234-107227256 AGTGAGGGCTCAGCAAATGTTGG + Intronic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
912633375 1:111268303-111268325 AGGAAGAACACAGTGATTGTAGG - Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
914639020 1:149584482-149584504 AGCAAGAGCACAGAGATTCTAGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
916360470 1:163962126-163962148 AGGGACAGCACAGTTATTGTGGG + Intergenic
917191251 1:172421847-172421869 AGGGAGGGCACAGCGATTGTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917373210 1:174317941-174317963 AGGGAGAACACAGCAACTGTGGG - Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917405039 1:174696678-174696700 AGGGAGAGAGCAGGGATTGTGGG - Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919001633 1:191839191-191839213 AGGGAGAGGAGAGCGATGGTGGG + Intergenic
919147336 1:193651935-193651957 AGGGAGAGCACAGTAACTGTGGG - Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
920596827 1:207280192-207280214 AGGGAGAGCACAGTTACTGTGGG - Intergenic
920616015 1:207493428-207493450 AGTGAGAGCAAATCGAATCTAGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
921774669 1:219082784-219082806 AGAGACAGCTCAGTGATTGTGGG - Intergenic
922388659 1:225114776-225114798 AGAGAGAGCACAGTGACTGTGGG - Intronic
923448425 1:234094038-234094060 CCTGAGTGCACAGCGACTGTGGG - Intronic
923734286 1:236588328-236588350 AGTGAGAGCCCAGATATTGACGG + Intronic
1064416518 10:15154689-15154711 AGTGAGAGCACAAAGATTCTAGG + Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065921716 10:30398959-30398981 AGGGAGAGTGCAGCAATTGTGGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1066981375 10:42419362-42419384 ATGGAGAGCACAGCAACTGTGGG - Intergenic
1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070286752 10:75089134-75089156 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1070505818 10:77111792-77111814 TTAGAGAGCACAGCCATTGTGGG - Intronic
1071962549 10:90821330-90821352 AGAAAGAGCACAGTGATTGTGGG + Intronic
1072058668 10:91787387-91787409 AGGAAGAGCACAGCAATTGTAGG + Intergenic
1073777113 10:106798599-106798621 AGTGAGATCACATCCTTTGTAGG - Intronic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075643196 10:124080044-124080066 AGTGAGAGGACAGGGATGTTGGG + Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078843194 11:15097726-15097748 AGGGAGAGCACAGTCATCGTGGG - Intergenic
1079150438 11:17894222-17894244 AGTGAGAGCACAGTGTAAGTTGG - Intronic
1079369149 11:19835419-19835441 AGTGAGAAGACAGCAGTTGTAGG + Intronic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081479068 11:43466963-43466985 AGTGAGAGCACAAATATTATAGG - Intronic
1082844998 11:57717925-57717947 AGTGAGAGCACAAAGATTCTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1086569519 11:88266027-88266049 AGGGAGAGCAGAATGATTGTGGG + Intergenic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1088330638 11:108647591-108647613 AGGGAGAGCAAAGTGAGTGTGGG + Intergenic
1088569814 11:111212528-111212550 AGGGAGAGCACAGCAATTGTGGG + Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1092473909 12:8802923-8802945 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1092477141 12:8828950-8828972 CGGGAGAGCACAGTGACTGTGGG - Intronic
1093931626 12:24960329-24960351 AGGAAGAGCACAGTGACTGTGGG + Intergenic
1094478637 12:30862273-30862295 AGTGAGAGCACAAAGATTATAGG - Intergenic
1094642989 12:32294684-32294706 AGTGAGAGACCAGTGATTGTAGG - Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095181823 12:39154805-39154827 AGGGAGAGCACAGCAATTGTGGG - Intergenic
1095874798 12:47068623-47068645 GATGAGAGCACAGGGAGTGTGGG + Intergenic
1095902394 12:47341499-47341521 AGTGAGAGCACAAAGATTATAGG + Intergenic
1096860258 12:54521479-54521501 AGTGAGAGCACAGATTTTGTTGG - Intronic
1097426140 12:59446707-59446729 AGACAGAGCACAGTGATTCTGGG - Intergenic
1098395201 12:70010213-70010235 AGGGACAGCACAGCAACTGTAGG + Intergenic
1099101011 12:78440094-78440116 AGGGAGAGCAAAGTGACTGTGGG - Intergenic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1099807831 12:87542812-87542834 AGGCAGAGCACAGCGACTGTAGG + Intergenic
1100838644 12:98590613-98590635 AGTGAGAGCACAAAGATTCTAGG + Intergenic
1101010156 12:100441149-100441171 AGAGAGAGCACAGAGAAGGTAGG - Intergenic
1101252100 12:102946556-102946578 AGGGACAGCAAAGGGATTGTGGG - Intronic
1101552027 12:105772193-105772215 GGGAAGAGCTCAGCGATTGTTGG - Intergenic
1103171405 12:118823266-118823288 AGTGTGAGCACAGGGACTGATGG + Intergenic
1104510140 12:129369951-129369973 AGTGGGAGCACAGCCAGCGTGGG + Intronic
1104726283 12:131077503-131077525 ATTGTGATCACAGCGATGGTGGG - Intronic
1106796101 13:33207726-33207748 AATGAAAGCACATGGATTGTTGG + Intronic
1107524317 13:41214709-41214731 AGGGAAAGCACAGCAATTTTGGG - Intergenic
1107753947 13:43599324-43599346 AGGGAGAGTGCAGCGATGGTGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107871697 13:44752467-44752489 AGTGACAGCTCAGCAAATGTTGG + Intergenic
1107947951 13:45436725-45436747 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1108686261 13:52821408-52821430 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110901401 13:80830356-80830378 AGGGAGAGCACAATGATGGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112710884 13:102127930-102127952 AGTGGGAGCAGAGCAAGTGTAGG - Intronic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113244428 13:108378253-108378275 AGGGATAGCACAGTGACTGTGGG - Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1115660885 14:35493601-35493623 TGGGGGAGCACAGTGATTGTGGG + Intergenic
1115887771 14:37992888-37992910 AGTGGGAACACAGGGATAGTTGG + Intronic
1115986600 14:39108808-39108830 AGTGAGAGCACAAAGATTATAGG - Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116504906 14:45665908-45665930 AGGAAGAACACAGCAATTGTGGG - Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117607108 14:57440959-57440981 AGAGAAAGAACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1118699739 14:68421590-68421612 AGCGAGAGCACAAAGATTCTAGG + Intronic
1118949120 14:70418060-70418082 AGTTAGACCACAGGGATTGGTGG + Intergenic
1118956532 14:70488219-70488241 AGAGAGAGCACAACAATTGGAGG + Intergenic
1119884816 14:78131455-78131477 GGTTAGAGCACAGGGCTTGTTGG + Intergenic
1120131000 14:80807786-80807808 TGTGAGAGCACAGCCATCATAGG + Intronic
1120426066 14:84350292-84350314 AGAGAGAGCCGAGTGATTGTAGG + Intergenic
1123794049 15:23753803-23753825 AGTGAGAGCAAAGCCATTATGGG - Intergenic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127971646 15:63966733-63966755 AGGGAGAGTGCAGCAATTGTGGG - Intronic
1128966136 15:72060532-72060554 AGAGATAGCACAGAGATTGTGGG + Intronic
1129260206 15:74362132-74362154 AGCGAGAGCACAAAGATTCTAGG - Intronic
1129469947 15:75747348-75747370 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1129642266 15:77392965-77392987 AAAGAGAGCACACCGCTTGTGGG + Intronic
1130099481 15:80881600-80881622 TGTGGGAGCACAGCGAGTGGCGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1132311099 15:100858567-100858589 AGTGAGAGCTCAGTGACTGAAGG - Intergenic
1138806933 16:60100906-60100928 AGAGCGAGCACAGTGACTGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139662566 16:68431086-68431108 AGTGGGAGGACAGGGATTGAGGG + Intronic
1141137454 16:81475601-81475623 AGTGAGAGCACAAAGATTCTAGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1144166872 17:12620830-12620852 AGTCAGATCACAGAGATTTTAGG - Intergenic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146080409 17:29774951-29774973 AGTGAGAGCACAACGAGTATAGG - Intronic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1150143040 17:62746018-62746040 TGTGAGAGCACAGCCTTTTTTGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1152584770 17:81183965-81183987 AGTGAGAACACAGCCATTCCAGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1153429702 18:5002641-5002663 AGTGAGAGCACACAAATTATAGG + Intergenic
1153904430 18:9648666-9648688 AGTAAGAGCTCAGCAAATGTTGG - Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157169924 18:45393802-45393824 AGTGAGAACTCAGTGAGTGTTGG - Intronic
1158558281 18:58492908-58492930 ACTGAGAGCACTGCTATAGTAGG + Intronic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1161728292 19:5943536-5943558 AGTGAGAGCCCAGAGAAGGTAGG + Intronic
1164588273 19:29491275-29491297 AGTGAGAACAAAGTGATTCTGGG + Intergenic
1164655961 19:29922058-29922080 AGTGAGAGCACAAAGATTATAGG - Intergenic
1164869372 19:31630437-31630459 AGTGAGAGCACAGAGCCTCTCGG + Intergenic
1166572519 19:43806693-43806715 AGTGAGAGCCCTGAGCTTGTTGG - Intronic
1167211502 19:48136669-48136691 AGTGAGAGCAAATCCATTGAGGG - Intronic
1167681691 19:50926970-50926992 AGTGAGAGCACAAAGATTCTAGG + Intergenic
925506439 2:4569891-4569913 AGAGAAAACACAGTGATTGTGGG - Intergenic
926516250 2:13850645-13850667 AGAGAGAGCACAGTAATTGTGGG + Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
927474109 2:23399203-23399225 AGTGACAGCACAAAGATTCTAGG - Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928726328 2:34178034-34178056 AAGGAGACCACAGCTATTGTGGG + Intergenic
929531228 2:42754324-42754346 AGTGAGAGAACTGTGTTTGTGGG + Exonic
930068603 2:47347240-47347262 AGTGAGACCACAGAGACTTTAGG + Intronic
930139767 2:47939623-47939645 AGTGACAGCACAAAGATTATAGG + Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930971402 2:57398799-57398821 AGAAAGAGCACAGTGATTGTGGG - Intergenic
931407012 2:61988945-61988967 AGGGAGAGTGCAGCAATTGTGGG - Intronic
932865894 2:75341585-75341607 AGTGAGTGCACATAGATTATTGG + Intergenic
934197166 2:89848189-89848211 GGAGAGAGCACAGGGAATGTAGG - Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
936555330 2:113492400-113492422 AGTGAGAACATAGCGATGTTTGG - Intronic
937597436 2:123687925-123687947 ATTAAGAGCACAGCTATTTTCGG - Intergenic
937664964 2:124476426-124476448 AGTGACATCACAGTGTTTGTGGG + Intronic
940191328 2:151043103-151043125 AGTGAGACTACAGTTATTGTGGG - Intronic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941528352 2:166633025-166633047 AGGGAGAGCCCAGCAATTCTGGG - Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942294761 2:174506952-174506974 AGAGAAAGCACAGCGAGTGTCGG + Intergenic
942477121 2:176339166-176339188 AGTGAGAGCACAAAGATTATGGG - Intergenic
942653323 2:178191225-178191247 AGTGAGAGTACAAAGATGGTTGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943237335 2:185338843-185338865 AGAGAGAGCACAGTGACTGTGGG - Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944046046 2:195413426-195413448 AGGAAGAGCACAGCAATCGTGGG + Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945529116 2:210927685-210927707 AGTGAGAGCACAGCACGTGCAGG - Intergenic
946626681 2:221619613-221619635 AATGGGAGAACAGCTATTGTTGG + Intergenic
946897721 2:224341345-224341367 CATGAGAACACAGAGATTGTGGG - Intergenic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948475616 2:238217116-238217138 GGAGAGAACACAGTGATTGTGGG - Intergenic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1169623824 20:7540200-7540222 AGGGAGAGCAAGGTGATTGTAGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172794989 20:37530629-37530651 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1173317426 20:41957711-41957733 AGTAAGTACACAGCGAATGTTGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1175327054 20:58137212-58137234 AGTGAGAGAACGGGGGTTGTTGG - Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176411746 21:6452856-6452878 AGGGAGAGCCCAACGATTATGGG + Intergenic
1176914448 21:14608309-14608331 AGGGAGAGCAAAGTTATTGTGGG + Intronic
1177271832 21:18858362-18858384 AGCGAGAGCACAAAGATTCTAGG - Intergenic
1179687240 21:43061178-43061200 AGGGAGAGCCCAACGATTATGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181687269 22:24538031-24538053 AGTGAGGGACCAGGGATTGTGGG + Intergenic
1181860844 22:25816958-25816980 AGCAACAGCACAGCTATTGTTGG + Intronic
1182389373 22:29978957-29978979 GGAGAGAGCACAGAGTTTGTGGG + Exonic
950683405 3:14600924-14600946 AGTGTGGGCAAAGCCATTGTTGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951379643 3:21968104-21968126 AGAGAGAGGAAAGGGATTGTGGG + Intronic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952132930 3:30385222-30385244 AGGGAGAGTACAGCAACTGTGGG - Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
952812011 3:37412334-37412356 AGGAACAGCACAGTGATTGTGGG - Intronic
953658637 3:44873943-44873965 AGCGAGAGCACAAAGATTCTAGG - Intergenic
954473363 3:50719371-50719393 AGCAAGAGCACAGTGATTATAGG + Intronic
954724626 3:52597101-52597123 AGTTAGAGCACAGTGATTGAGGG - Intronic
955604809 3:60690114-60690136 AGTGAAAGCACAAAGATTCTAGG + Intronic
956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG + Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957569349 3:81926294-81926316 AGTGAGATCATAGCTTTTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959719553 3:109471218-109471240 AGCGAGAGCACAAAGATTCTAGG + Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960380990 3:116961435-116961457 AGTGTTAGCACAGAGATTATAGG + Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
962774185 3:138643406-138643428 AGTGAGAGCACAAAGATTATAGG + Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963154023 3:142077043-142077065 AGGGAGAGCTCAGTGACTGTGGG + Intronic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
966454107 3:180095059-180095081 AGGGAGAACACGGTGATTGTGGG - Intergenic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
974224361 4:59019227-59019249 AGAGAAAGCACAGTGATTGTCGG - Intergenic
974813060 4:66970713-66970735 AGTAAGAGCATGGCCATTGTGGG + Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
975715037 4:77197382-77197404 AGTGAGAGCAGAGCGGTGGCTGG + Intronic
976082940 4:81376033-81376055 GGGGAGGGCACAGCGATTGTGGG - Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
976770250 4:88644562-88644584 AGTGAGAGAAAACAGATTGTTGG + Intronic
977381120 4:96274851-96274873 AGAGAGACCACAGCAACTGTGGG - Intergenic
978096419 4:104784456-104784478 AGAGAAAGCACAGAGACTGTGGG - Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978934726 4:114360283-114360305 AGGGAGAGCACAGAGACTGCCGG - Intergenic
979734257 4:124063076-124063098 AGTGAGAGCACAAAGATTCTAGG - Intergenic
979866408 4:125760450-125760472 AGTGAGAACACTGCTATTGCTGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
980956505 4:139434025-139434047 AGGGAGATCGCAGTGATTGTGGG - Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981384667 4:144115500-144115522 TGTGACAGCACTGCAATTGTGGG - Intronic
981530910 4:145752945-145752967 AGTGAGAGCACAGCGATTGTGGG - Intronic
982817635 4:159906374-159906396 AGTTAGAGCTCAGTGATGGTGGG - Intergenic
982817657 4:159906741-159906763 AGTGAGAGCACAGTGACTGTAGG + Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983417627 4:167479369-167479391 AGGGAGAGCAAAGTGACTGTGGG + Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986155912 5:5175813-5175835 AGGGAGAGAACAGCGATCATGGG - Intronic
987069061 5:14318690-14318712 ATTGAGAGGACAGACATTGTGGG + Intronic
987537289 5:19205968-19205990 AGGAAGAACACAGCGATTGCAGG + Intergenic
988265427 5:28942666-28942688 TGGGAGAGCACAGTTATTGTGGG - Intergenic
989564872 5:42892205-42892227 AGCGAGAGCACAAAGATTATAGG + Intergenic
989672498 5:43935505-43935527 AGGGAAAGAACAGCAATTGTGGG + Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
992261697 5:74977220-74977242 AGTGATAGAACAGCCATTTTGGG + Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
992966663 5:82009488-82009510 AGCGAGAGCACAAAGATTCTAGG + Intronic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994330501 5:98499902-98499924 AGTGAGAGCAAAGTGACTGGTGG - Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995245155 5:109927120-109927142 AGTGAAAGCACAATGATTGGGGG + Intergenic
995614354 5:113944306-113944328 AGTGAAAGCACAGTGAATGCTGG + Intergenic
995836344 5:116403258-116403280 AGTGAAAGCACAGCAATGGTGGG - Intronic
996258523 5:121436507-121436529 AGTGAGATGATAGCCATTGTGGG + Intergenic
996653715 5:125913992-125914014 AGGAAGAGCTCAGTGATTGTGGG - Intergenic
996659856 5:125988954-125988976 AGGGACAGCAAAGTGATTGTGGG - Intergenic
997627865 5:135343179-135343201 AGTGAGAGCACCACAATTATGGG + Exonic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
1000209496 5:159096993-159097015 ATCGAGAGGACAGCGTTTGTGGG - Exonic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002259931 5:177985838-177985860 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259953 5:177985926-177985948 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259956 5:177985941-177985963 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1002259963 5:177985971-177985993 AGTGTGGGCACGGCGAGTGTGGG + Intergenic
1003007007 6:2391721-2391743 AGTGAGTGCTCAGTGACTGTGGG + Intergenic
1005089843 6:22044876-22044898 AGTGAGAGCACCAAGACTGTGGG + Intergenic
1009557777 6:65196697-65196719 AGTAAGAGCACAGCGAATGAAGG + Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1009847456 6:69151400-69151422 TGGGGGAGCACAGTGATTGTGGG - Intronic
1009978786 6:70701664-70701686 AGGGAGAACGCAGTGATTGTGGG - Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010557815 6:77306526-77306548 AGTGAGAGTGCAGGAATTGTGGG - Intergenic
1011340892 6:86313219-86313241 AGGGAGACCACAGCAATTGTAGG + Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1014430536 6:121365379-121365401 GGAGAGAGCACAGCAATTGTGGG + Intergenic
1015460595 6:133487086-133487108 AGGGAGAGCTCAGTGAGTGTAGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016229684 6:141788279-141788301 AGGGAGAGCATAGTAATTGTGGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1018737492 6:166698442-166698464 AGTGAGAGCAAAGTGAGTATAGG + Intronic
1019136115 6:169908765-169908787 AGTGTGAGCACAGCCCATGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022223700 7:28340921-28340943 AGAGACAGCACAGTGATTATGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023716136 7:43046303-43046325 AGTGACAGCACAGTGATTGTGGG + Intergenic
1023945728 7:44801508-44801530 AGCGAGAGCACAAAGATTCTAGG - Exonic
1024700099 7:51897599-51897621 AGAGAGAGCAAAGTAATTGTCGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028207662 7:88034819-88034841 AGGGAGAGCACAGCAATTGTGGG - Intronic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1030662620 7:112238247-112238269 AGGGAGAGCGCAGTAATTGTGGG + Intronic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031657735 7:124379452-124379474 AGTGAGACCACAGTGATCATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032939028 7:136767577-136767599 AGAGAGAGCACAGCAACTGGGGG + Intergenic
1033125451 7:138703042-138703064 AGTGAGGACACAGTCATTGTTGG + Intergenic
1033760796 7:144434715-144434737 AGCAAGAGCACAACGATTATAGG + Intergenic
1033814120 7:145051648-145051670 AGAGAAAGCACGGTGATTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1034581920 7:152050925-152050947 AGGGAGAGGGCAGGGATTGTAGG - Intronic
1035346815 7:158205776-158205798 AGAGAGAGCACAGTGATAGTGGG + Intronic
1037076801 8:14730616-14730638 AGTGAGAGCACATGGATGTTCGG + Intronic
1040108988 8:43557749-43557771 ATTAAGAGCACAGCTATTTTCGG + Intergenic
1040290280 8:46120655-46120677 AATGAGACCACAGCGATTGTTGG - Intergenic
1040293257 8:46136207-46136229 GGTGAGACCACAGAGAATGTTGG - Intergenic
1040296303 8:46150850-46150872 AGTGAGACAACAGGGAATGTTGG - Intergenic
1040300305 8:46184551-46184573 AGTGAGACCACAGGGAATGCTGG - Intergenic
1040300835 8:46187215-46187237 AGTGAGACCACAGGGATGCTGGG - Intergenic
1040303680 8:46201179-46201201 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040314292 8:46252819-46252841 AGTGAGAACACAGGGAATGCTGG + Intergenic
1040325122 8:46337770-46337792 AGTGAGACCACAGGGAATGCTGG + Intergenic
1040329383 8:46378197-46378219 AGTGAGACCACAGGGAATGCTGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1044124165 8:88437342-88437364 AGGGAGAGCCCAGCGATTCTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1046691889 8:117295106-117295128 AGTGAGGGCTCAGTGAGTGTTGG + Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048797914 8:138168249-138168271 AGTTAGAGGACATGGATTGTAGG + Intronic
1049897664 9:124788-124810 AGTGAGAACATAGCGATGTTTGG + Intronic
1051022616 9:12562839-12562861 AGTTGGAGCACAGAGAATGTGGG + Intergenic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052258900 9:26491793-26491815 AGGGAGAACACAGCAGTTGTGGG - Intergenic
1053740755 9:41135076-41135098 AGTGAGAACATAGCGATGTTTGG + Intronic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054443744 9:65291231-65291253 AGTGAGAACATAGCGATGTTTGG + Intergenic
1054486530 9:65730272-65730294 AGTGAGAACACAGCGATGTTTGG - Intronic
1054687595 9:68296223-68296245 AGTGAGAACATAGCGATGTTTGG - Intronic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1055464308 9:76549171-76549193 AGTGAGAACACAAAGATTATAGG + Intergenic
1055615913 9:78072743-78072765 AGTGAAGGCACAGGGAATGTAGG + Intergenic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060126612 9:121053729-121053751 AGAGAGAGCAAAGTGAGTGTGGG + Intergenic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060624243 9:125095978-125096000 AGTGAGAGCACAGGGTTGGGAGG - Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1187575125 X:20545995-20546017 AGGGACAGCACAGCAATTGTGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189575504 X:42348833-42348855 AGTGGGAGCAAAGAGCTTGTGGG + Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1190122597 X:47674549-47674571 AGGGAGAACACAGTGAATGTGGG - Intergenic
1190797382 X:53758251-53758273 AGTGAGCGCACAGCAAGTGCAGG - Intergenic
1190913187 X:54790431-54790453 AGTGAGTGCACAGCAAGTGCAGG - Intronic
1191812497 X:65204037-65204059 AGAGAGAACACAATGATTGTGGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192418534 X:71007195-71007217 CGTGAGAGCACATGAATTGTCGG - Intergenic
1192690085 X:73353692-73353714 AGTGAGACCAGAGTGCTTGTTGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1192858609 X:75040694-75040716 AGAGAGAGAACAGTGATAGTGGG - Intergenic
1193052535 X:77116265-77116287 AGGGAGAGTGCAGCAATTGTGGG - Intergenic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193802349 X:85951912-85951934 AGTGAGAGCATAGCAACTGGGGG + Intronic
1193912137 X:87318258-87318280 AGCGAAAGAACAGCAATTGTGGG - Intergenic
1193933198 X:87582386-87582408 AGGGATAACACAGCAATTGTGGG + Intronic
1194095647 X:89636024-89636046 AGGGACAGCACAGCAATTGTGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194693043 X:97010244-97010266 AGAGAGAGCACAATGATTGTGGG - Intronic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1194937740 X:99971124-99971146 AGGGAGAGCACAATTATTGTGGG - Intergenic
1195018337 X:100800188-100800210 AATGAGAGCACAAAGATTATAGG + Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195543435 X:106088249-106088271 AAGGAAAGCACAGCAATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1197053802 X:122093477-122093499 GGGAAGAGCACAGCGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197399871 X:125977356-125977378 AGGGAAAGCAAAGTGATTGTGGG + Intergenic
1197439220 X:126470281-126470303 AGGGAAAGCATAGTGATTGTGGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197514697 X:127411270-127411292 AGAGACAGCACAGTGATTGTGGG - Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1199138997 X:144287957-144287979 AGGGAGAGCACAGCAAGTGAGGG - Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199751145 X:150819333-150819355 AGTGAGTGCACAAAGATTATAGG - Intronic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1199962820 X:152791773-152791795 AGAGAGAGGGCAGTGATTGTGGG + Intergenic
1200448646 Y:3297392-3297414 AGGGACAGCACAGCAATTGTGGG + Intergenic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200846271 Y:7834549-7834571 ATTAAGAGCACAGCTATTCTCGG - Intergenic
1201473968 Y:14361268-14361290 AGTCAGAGCACTGGTATTGTGGG - Intergenic