ID: 981531279

View in Genome Browser
Species Human (GRCh38)
Location 4:145756024-145756046
Sequence CCTTCGTCCCCACAGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981531274_981531279 12 Left 981531274 4:145755989-145756011 CCGCTTCCATCTCTCACTAAGCA 0: 1
1: 0
2: 0
3: 14
4: 292
Right 981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 123
981531273_981531279 13 Left 981531273 4:145755988-145756010 CCCGCTTCCATCTCTCACTAAGC 0: 1
1: 0
2: 0
3: 11
4: 249
Right 981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 123
981531275_981531279 6 Left 981531275 4:145755995-145756017 CCATCTCTCACTAAGCACCTCTT 0: 1
1: 0
2: 1
3: 21
4: 291
Right 981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981531279 Original CRISPR CCTTCGTCCCCACAGACTGA AGG Intronic
901403656 1:9031853-9031875 CCTCTGTCCCCACAGACTTGGGG - Intergenic
902595493 1:17506789-17506811 CCTTAGCCCCATCAGACTGACGG + Intergenic
904808216 1:33146504-33146526 CCTTCCTGCCCACAGGCCGAGGG - Exonic
906213226 1:44023915-44023937 CCTTGATCAGCACAGACTGAAGG + Intronic
907160031 1:52362845-52362867 CATTGGGCCTCACAGACTGAAGG - Intronic
919002238 1:191847515-191847537 CCTTAGATCCCACAGGCTGAGGG + Intergenic
922154526 1:223030686-223030708 CTTTCTGCCCCCCAGACTGATGG + Intergenic
1062952541 10:1515617-1515639 CCTTTGTCCCCACAGTGAGAGGG + Intronic
1063355555 10:5395362-5395384 CCTCCGACCCCACAGAGTAACGG + Exonic
1067072609 10:43146224-43146246 CCTTTGGCTGCACAGACTGAAGG - Intronic
1069556821 10:69403782-69403804 CCTTTGTATCCACAGCCTGATGG + Intergenic
1070599451 10:77855670-77855692 CCTTCGGGCCAACTGACTGAGGG + Intronic
1074104535 10:110378712-110378734 CCATAATCCCCACATACTGAGGG + Intergenic
1076646277 10:131957206-131957228 CCTTCATCTCCACAGGCGGACGG - Intronic
1076646572 10:131958426-131958448 CCTTCATCCCCACAGGGGGATGG - Intronic
1076799849 10:132815777-132815799 CCTTCCTCCCCACTTCCTGACGG - Intronic
1077485440 11:2836353-2836375 CATGCCTCCCCACAGACAGACGG - Intronic
1077518534 11:3017057-3017079 CCTGTGTCCACACAGGCTGAGGG + Intronic
1080101685 11:28466879-28466901 CCTCCTCCCCAACAGACTGAAGG - Intergenic
1084433919 11:69127074-69127096 GCTTAGTCCCTACAGATTGACGG + Intergenic
1085470317 11:76753438-76753460 CCATCTTCCCCACAGACTGTGGG - Intergenic
1087348978 11:97006793-97006815 CCTTTGTTCCCTCAGACTTAGGG + Intergenic
1088756454 11:112889459-112889481 CCCACTTCCCCAGAGACTGAAGG + Intergenic
1089739828 11:120574765-120574787 CTCCCCTCCCCACAGACTGATGG - Intronic
1091664582 12:2410087-2410109 GCTTCGTCCTCTCAGACTGTGGG + Intronic
1095437092 12:42201820-42201842 CCTTGGTCTCCCCAGATTGATGG + Intronic
1098624364 12:72644457-72644479 CCTTGGTCAGCACAGAGTGATGG + Intronic
1099567497 12:84271069-84271091 CCTTGTTCCCCACAGAATAAAGG - Intergenic
1103040787 12:117693776-117693798 CCGTCATCCCCACTGACAGATGG + Intronic
1106460593 13:29964358-29964380 CCCTCCTCCACACAGCCTGATGG - Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1112461969 13:99610660-99610682 CCTGCTTCCACAGAGACTGAAGG + Intronic
1115333987 14:32227248-32227270 CCTTCCTCCTGACTGACTGAGGG - Intergenic
1117548925 14:56814657-56814679 CCTTGGTCCCCACACTCTCAGGG - Intergenic
1122055870 14:99097983-99098005 CCTTCTTCCCCATTCACTGAAGG + Intergenic
1126796151 15:52261778-52261800 CCTTTGTCCACACTGGCTGAAGG - Intronic
1129183833 15:73893755-73893777 CCTTCCTCCCCACTGACCAAAGG - Intergenic
1129670518 15:77605461-77605483 CCTTCGCCCCCACTGCCTGTGGG + Intergenic
1129696303 15:77742302-77742324 CCTTCCTCCCCACAGCCTCTGGG + Intronic
1130508089 15:84565490-84565512 CCTGAGTCCCCAGATACTGAGGG + Intergenic
1130586031 15:85183239-85183261 CCTGAGTCCCCAGAGACTGAGGG - Intergenic
1137454942 16:48610769-48610791 CCTCTGCCCCCACAGACTGCTGG - Intronic
1137864136 16:51876165-51876187 CCTTCTTCCCACCAAACTGAGGG + Intergenic
1139352217 16:66343881-66343903 CCTCCATCCCCACAGTCTGAGGG + Intergenic
1139459998 16:67114136-67114158 CCTTGTTCCACAGAGACTGAAGG + Intronic
1140692051 16:77493931-77493953 CCTTCGTTCCAAAAGAATGAGGG - Intergenic
1143562301 17:7703301-7703323 CCTTCGTCCCCACTCTCTGTGGG - Exonic
1145232407 17:21183622-21183644 CCTTCGACCTCACAGACTCTGGG + Exonic
1145745362 17:27315102-27315124 CCTTCTTCCCCACAGACAAATGG - Intergenic
1146054761 17:29575545-29575567 CCTTGGTCCTCACACACTGGGGG + Intronic
1148805709 17:50262993-50263015 CCTGTCTCCCCTCAGACTGAGGG + Intergenic
1149553413 17:57556505-57556527 CCTCCCACCCCAAAGACTGATGG - Intronic
1151422256 17:74006203-74006225 CCTGCGTCCCCTCACAATGAAGG + Intergenic
1151964234 17:77422922-77422944 CCCTCGTCCCCACAGCCTTCTGG + Intronic
1152226151 17:79093863-79093885 CCTTCCACCCCACAGCCTGAGGG + Intronic
1152241150 17:79161896-79161918 CCCTGGTCCCCACAGAGTGTGGG - Intronic
1153004508 18:485399-485421 GCTTCTTCCCCGCAGACAGATGG - Intronic
1155049724 18:22136061-22136083 CATTCATCCCCACAGAAGGAAGG - Intergenic
1159450773 18:68599252-68599274 CCTCCCTCCCCACAGTTTGAAGG + Intergenic
1160900185 19:1424095-1424117 TCTTCCTCTCCACTGACTGAAGG + Intronic
1161143371 19:2662396-2662418 CCTTGGACCCCACAGGTTGAGGG + Intronic
1165762503 19:38329882-38329904 CCATAGCCCCCACAGACTGGAGG + Intergenic
925927694 2:8681971-8681993 CCTTCGTCCCCATTGGCGGAAGG - Exonic
926616777 2:15003624-15003646 CCTTCGTCCCCTCACTCTCAAGG - Intergenic
927051300 2:19331983-19332005 CCTTGGGGCCCACAGACTGAGGG - Intergenic
927315265 2:21674407-21674429 CCTAGGTCCACACTGACTGAGGG + Intergenic
927432060 2:23035065-23035087 ACCCCGTCCCCACAGCCTGAAGG - Intergenic
932946712 2:76241956-76241978 CCTTGGTCCTCACAGGCTGTGGG + Intergenic
934164230 2:89279854-89279876 CTTTAGTCACCACAGATTGAGGG + Intergenic
934203044 2:89902670-89902692 CTTTAGTCACCACAGATTGAGGG - Intergenic
937462426 2:122101118-122101140 CCTTTGTTCCCACAGCCTTAGGG - Intergenic
938110373 2:128560249-128560271 CCTTCATCCACACAGACAGATGG - Intergenic
940510077 2:154602477-154602499 CCTTCGGCCTCCCAGACTGCTGG + Intergenic
940619025 2:156087323-156087345 CCTACCTCCCCACAAAGTGATGG - Intergenic
1168866391 20:1090517-1090539 CCTTCGCCCTCCCAGGCTGAAGG + Intergenic
1171353933 20:24529106-24529128 TCTTCCTCCCCACCCACTGAAGG - Intronic
1172391449 20:34567998-34568020 CCTTTCTCTCCACAGACCGAGGG + Intronic
1175263005 20:57686490-57686512 CCTTGGACCACACAGCCTGAAGG - Intronic
1176905721 21:14498142-14498164 CCTGCATTCCCAAAGACTGAGGG - Intronic
1179100466 21:38351632-38351654 CCTTCCTCACCCCATACTGAGGG + Intergenic
1179254953 21:39707501-39707523 CTTTCCTCCCCACAGCCTAATGG + Intergenic
1183945034 22:41320642-41320664 CTCTCTTCCCCAGAGACTGATGG + Exonic
1184660984 22:45965416-45965438 CCTTCATGCCCACAGCGTGACGG - Intronic
1184980516 22:48092186-48092208 CCTTCAACCCCTCAGTCTGAAGG - Intergenic
950003830 3:9678527-9678549 CCTTAGCCCACACAGTCTGAAGG + Intronic
950145024 3:10642855-10642877 GCTTCCTCCCCATACACTGAGGG + Intronic
954745084 3:52783160-52783182 CCTCTGTCCCCTCAGAATGAGGG + Intronic
961540158 3:127593943-127593965 CCTTTGTCATCACAGTCTGAAGG + Intronic
965622703 3:170656670-170656692 CCTCCCTCACCACAGCCTGATGG + Intronic
967855540 3:194114807-194114829 CTTTCATCCCCAGAGAATGAGGG - Intergenic
969695314 4:8730917-8730939 CCTCCCTCCCCACACACTGAGGG - Intergenic
973245086 4:48002859-48002881 CCCTCCTCCCCACAGCCTGATGG + Intronic
974637174 4:64580060-64580082 CCATTGTCCCCTAAGACTGACGG - Intergenic
978884950 4:113757774-113757796 GCTTCTTCTCCACAGATTGAAGG + Intronic
981531279 4:145756024-145756046 CCTTCGTCCCCACAGACTGAAGG + Intronic
981619237 4:146675024-146675046 CCTTCCTGCCCACTGACTCATGG + Intergenic
985519924 5:369373-369395 CCCTCCTGCCCACAGCCTGAAGG + Intronic
989009898 5:36858151-36858173 CCTTGGTCCCCACAAAGTGCTGG + Intergenic
998456980 5:142281035-142281057 CCTTCCTCTCCACAAACCGAGGG - Intergenic
998757884 5:145400671-145400693 CCCTCCTTCCCACAGACTGGTGG - Intergenic
1000942214 5:167375354-167375376 CCCTCTGCCCCACAGTCTGATGG - Exonic
1000949540 5:167463743-167463765 GCTTCGGCCCCCCAGACTGTTGG + Intronic
1001470714 5:172010567-172010589 CCTTCCTCCCCACACACAAAGGG + Intergenic
1001766163 5:174248880-174248902 CCCTCGGCCCCACAAACTGCTGG - Intergenic
1004128625 6:12898293-12898315 CCTTCGTCTCCAAATACCGACGG + Intronic
1004188256 6:13440906-13440928 TGTTCCTCCCCACAGACAGAAGG + Intronic
1004861203 6:19806097-19806119 CCCTCGGCCCCACAGAGTGCTGG - Intergenic
1007342802 6:41202200-41202222 GCTGGGTCCCCACACACTGAAGG - Intergenic
1007347429 6:41242837-41242859 GCTGGGTCCCCACACACTGAAGG + Intergenic
1014169635 6:118264658-118264680 CCTTCAGCTCCACTGACTGAGGG + Intronic
1018889892 6:167976233-167976255 CCTCCTTCCCCACACACTGCAGG - Intergenic
1019168364 6:170114599-170114621 CCTCAGACCCCACAGAATGAAGG + Intergenic
1023611629 7:41977625-41977647 CCTTCGTGCTCACAGACGTATGG + Exonic
1026854278 7:73742915-73742937 CCTTGGTCCCCACGGCCTGAAGG - Intergenic
1030127474 7:106168305-106168327 CCCTCTTCCACACAGACAGAGGG - Intergenic
1030370934 7:108698298-108698320 CCTTGGTCCCTACATATTGAAGG + Intergenic
1032440199 7:131936969-131936991 CCTTAGTCCCCACACATTGTGGG + Intergenic
1034309987 7:150079029-150079051 CCTTCATCCCCACATACACAGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035819835 8:2579566-2579588 CAGTCGTCCACACAGACCGAAGG + Intergenic
1035842940 8:2832192-2832214 CCCTCCTCCCCACAGACTCACGG - Intergenic
1038384539 8:27129890-27129912 GCTTCGTCCCCACAAAGTGCTGG - Intergenic
1038521354 8:28234960-28234982 CCTTCTTCCTCACAGAAAGAAGG - Intergenic
1042915152 8:73868187-73868209 CCTTCTTCCCCAAAGATTGATGG - Intronic
1048908371 8:139110478-139110500 CCTTCTCAGCCACAGACTGAAGG - Intergenic
1048920940 8:139229489-139229511 CATTCATCTCCGCAGACTGAGGG - Intergenic
1055791611 9:79928696-79928718 CCTCATTCCCCACAGGCTGAAGG - Intergenic
1056795858 9:89658484-89658506 CCTTCATCTGTACAGACTGACGG + Intergenic
1060937582 9:127524626-127524648 CCTCCATCACCACAGAATGAAGG + Intronic
1061809180 9:133152553-133152575 CCTGTGTCCCCACTGCCTGATGG + Intergenic
1186368796 X:8925632-8925654 CCCTGGTCCCCCCAGAATGAAGG + Intergenic
1194641211 X:96406047-96406069 CCCTCCTCCCCTCAGCCTGATGG - Intergenic
1198512085 X:137362195-137362217 TCTTCTTGCCCACAGACTTACGG - Intergenic
1202248674 Y:22845616-22845638 CCTTTGTCCCCAGAAACTGGAGG + Intergenic
1202401663 Y:24479364-24479386 CCTTTGTCCCCAGAAACTGGAGG + Intergenic
1202469118 Y:25190719-25190741 CCTTTGTCCCCAGAAACTGGAGG - Intergenic