ID: 981531927

View in Genome Browser
Species Human (GRCh38)
Location 4:145761794-145761816
Sequence GCTGACAAGCAGCTCTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981531922_981531927 -2 Left 981531922 4:145761773-145761795 CCTGCTGACAGAGCAGTCCCCGC 0: 1
1: 0
2: 1
3: 11
4: 100
Right 981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 170
981531919_981531927 13 Left 981531919 4:145761758-145761780 CCCTTTTTGGCTCTCCCTGCTGA 0: 1
1: 0
2: 2
3: 21
4: 235
Right 981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 170
981531920_981531927 12 Left 981531920 4:145761759-145761781 CCTTTTTGGCTCTCCCTGCTGAC 0: 1
1: 0
2: 0
3: 12
4: 194
Right 981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 170
981531921_981531927 -1 Left 981531921 4:145761772-145761794 CCCTGCTGACAGAGCAGTCCCCG 0: 1
1: 0
2: 0
3: 6
4: 211
Right 981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG 0: 1
1: 0
2: 1
3: 18
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981531927 Original CRISPR GCTGACAAGCAGCTCTGGCA AGG Intronic
901118266 1:6866909-6866931 GAAGACAAGCAGCTCAGGGATGG + Intronic
901450468 1:9333619-9333641 GCTGACAAGGAGGGCGGGCATGG - Intronic
903595450 1:24490358-24490380 ACTGGCGAACAGCTCTGGCACGG + Intergenic
904928558 1:34067680-34067702 GTTGACAAACTGCTCTGGAAAGG - Intronic
905656023 1:39686619-39686641 GCTGAGAAGCAGGTTTGGGAAGG + Intronic
913360036 1:117970369-117970391 GCTGACGAGCAGCCCAGGCTTGG + Intronic
915573627 1:156760425-156760447 GCTGGGCAGCAGCTCTGGCTAGG + Intronic
916712125 1:167420767-167420789 GCTGACAGGTGGCTCTGGCCTGG + Exonic
916791660 1:168130405-168130427 GATCCCCAGCAGCTCTGGCAAGG - Intronic
917595135 1:176521646-176521668 ACTGACGTGCAGCTTTGGCAAGG + Intronic
917679097 1:177348083-177348105 GCAGACAAGCTGGTCTGGAAGGG - Intergenic
918373086 1:183881333-183881355 GATGACAATCTGCACTGGCAGGG - Intronic
919897546 1:202018561-202018583 GGTGACCAGCAGCTCCGGCAGGG - Intergenic
1066309490 10:34182224-34182246 TCTGACAGGCAGCTCCAGCAAGG + Intronic
1067036915 10:42927646-42927668 GCTCAGCAGCAGCTCTGCCAGGG - Intergenic
1067058295 10:43064889-43064911 GCAGAGAGGCAGCTCAGGCATGG + Intergenic
1067079503 10:43205163-43205185 GCTGACAAGCAGGGCAGGGAGGG + Intronic
1068575553 10:58680315-58680337 GCTGATAAGCAGCTTCAGCAAGG + Intronic
1071058245 10:81536187-81536209 GCTGACAAGCAGCCATGTTAGGG + Intergenic
1072364941 10:94699756-94699778 GCTGACAAGCAACTTCAGCAAGG + Intronic
1074582553 10:114734220-114734242 GGTGACAAGGAGCTGGGGCAGGG - Intergenic
1074599403 10:114898445-114898467 GCTGATAACCAGCTCTGGCCTGG + Intronic
1077434222 11:2531035-2531057 GCTGACAGACAGCCCTGGCTGGG - Intronic
1077547651 11:3182491-3182513 GCTGCCAAGCTCCTCTGGCAAGG - Intergenic
1077548259 11:3186354-3186376 GCTGCCAAGCTCCTCTGGCAAGG - Intergenic
1081540891 11:44033805-44033827 ACTGAGCCGCAGCTCTGGCAAGG + Intergenic
1083298049 11:61725825-61725847 ACTGGCCACCAGCTCTGGCAGGG + Intronic
1084212243 11:67629643-67629665 GCTGGCAGGGACCTCTGGCAGGG - Intronic
1085758672 11:79223230-79223252 CCTAACAAGAAGCACTGGCAGGG + Intronic
1089397275 11:118144667-118144689 GCTGAGAAGCTGGACTGGCAGGG - Intronic
1103328721 12:120138913-120138935 GCAGACAAGAAGCACAGGCAGGG + Intronic
1104661069 12:130611752-130611774 CCTGACAAACAGCTCAGGCCCGG + Intronic
1104961989 12:132492625-132492647 GCTGTCCACCTGCTCTGGCAGGG + Intronic
1106239556 13:27899970-27899992 GCTGAAAAGCAGATATGGAAAGG + Intergenic
1106407227 13:29484536-29484558 GCAGACTGGGAGCTCTGGCATGG + Intronic
1107404739 13:40101929-40101951 ACTGACAGGCAGCACTGCCAAGG + Intergenic
1108352996 13:49604286-49604308 GCTCACACGCAGCTCTCCCACGG - Intergenic
1108978722 13:56483172-56483194 GCTGGCAAATTGCTCTGGCAGGG + Intergenic
1112572463 13:100606597-100606619 GCTGACAAGGAGCAGTGGGAGGG + Intronic
1113342803 13:109443349-109443371 GCTGATAAGCAACTTTAGCAAGG - Intergenic
1115955701 14:38776931-38776953 GACTACAAGCAGCTCTGGAAAGG + Intergenic
1120101061 14:80446091-80446113 GCTGAAGAGCAGCTCTAACAAGG + Intergenic
1120162859 14:81164174-81164196 GTTTTCAAGCAGCTCTAGCAAGG - Intergenic
1121269908 14:92631187-92631209 ACTGACAAGAGGCTCTGGGAAGG - Intronic
1122505440 14:102228915-102228937 ACTGACCAGCAGCGCTGGGAAGG + Exonic
1123013017 14:105358274-105358296 GCTGACCAGCAGTTCTGGCTGGG + Intronic
1124848874 15:33316873-33316895 GCTGTCCAACAGCTCTGGGATGG - Intronic
1124903873 15:33849771-33849793 ACTGAGAAGCAGCTCTGCAAAGG + Intronic
1125354721 15:38804939-38804961 GAGGACGAGCAGCTCAGGCAGGG + Intergenic
1125617368 15:41026883-41026905 GCTGACAAGCATTGCTGGAAAGG - Intronic
1125884019 15:43215020-43215042 GCTGGGGTGCAGCTCTGGCAGGG - Intronic
1127959841 15:63882562-63882584 GCTGTGGAGCAGCTATGGCAGGG - Intergenic
1128716597 15:69913257-69913279 GCAGATAAGCAGCCCTTGCATGG - Intergenic
1129296338 15:74602291-74602313 GCTGAGGAGCATCTCTGGGAGGG + Intronic
1129575755 15:76743428-76743450 ACTGATAAGCTGTTCTGGCAAGG + Intronic
1129707143 15:77801009-77801031 GATAACAAGCAGTGCTGGCAAGG + Intronic
1133295000 16:4747402-4747424 GCTGGCAGGCAGCTCGGGCTGGG - Exonic
1133529618 16:6642522-6642544 GCAGACAAGCAGAGCTGGCGTGG - Intronic
1134079728 16:11316484-11316506 GCTGACAAGCCAGCCTGGCACGG + Intronic
1135056838 16:19238942-19238964 GCTGACTGGCAGCTCTGGGTTGG - Intronic
1137758995 16:50925410-50925432 ACAGACAAGCAGCCCTGGGAGGG + Intergenic
1138152801 16:54674632-54674654 GCTGAATAGCAGCACTGGCTCGG - Intergenic
1139029137 16:62858202-62858224 GCTTATAAGCAGCTCTTACATGG + Intergenic
1139331927 16:66199464-66199486 GCTGTCTACCAGCTCTGGCTAGG + Intergenic
1139844897 16:69913594-69913616 GCTGAAAAACAGCTTTGGAAAGG + Intronic
1141589105 16:85055990-85056012 GCTGAGCTGCAGCACTGGCAAGG - Intronic
1143463970 17:7123303-7123325 GCTGGCAACCAGCTCTCCCACGG - Intergenic
1143599032 17:7932037-7932059 TCTGACAAGCAGCACTGGAGCGG - Intronic
1144013357 17:11171101-11171123 GCATACAAGCAGCTCAGACAGGG - Intergenic
1144385505 17:14745756-14745778 GATGAGAAGCAGCTCTGGAATGG - Intergenic
1144670649 17:17130799-17130821 ACTGACAGGCAGCTCTGGCAAGG + Intronic
1144937107 17:18908663-18908685 GATGGCCAGCAGCTCTGGCTTGG - Intronic
1145113806 17:20189454-20189476 AATGCCAAGCAGCTCTGGGAGGG - Intronic
1145797433 17:27664012-27664034 GCTGTGGAGCAGCTCTGGCTGGG + Intergenic
1146599809 17:34204707-34204729 CCTGACAAGCAGCTCAGCTAGGG + Intergenic
1148046423 17:44747780-44747802 GTTGATAAGCAGTTCTGGCCAGG + Intronic
1148719506 17:49740766-49740788 GCTGAAAATCAGCTCAGGCCTGG + Intronic
1149455650 17:56785954-56785976 CCTGACAAGCAGCTCTGGGTGGG + Intergenic
1150725870 17:67650889-67650911 ACTGAAAGGCAGCTGTGGCAAGG - Intronic
1151446712 17:74170955-74170977 GAAGACAAGGAGCTCTGGGAAGG + Intergenic
1152138575 17:78522631-78522653 GCCGGCCAGCAGCTCTGGCCTGG - Intronic
1152153687 17:78618860-78618882 GAAGACAGGCAGCTCAGGCAGGG + Intergenic
1159527535 18:69612496-69612518 GCAGACGAGCAGCTCATGCACGG - Intronic
1161932454 19:7349958-7349980 GCTGACAACCAGCCCTGAGAAGG + Intronic
1162490576 19:10989010-10989032 GTTTTCATGCAGCTCTGGCATGG - Intronic
1163600937 19:18248577-18248599 GGGGACCAGCAGCTCTGGGAAGG + Intronic
1168234105 19:55051204-55051226 GCTTCCACGCAGCTCTGTCACGG - Intronic
925397961 2:3550254-3550276 GCAGATAAGTAGCTCTGGCAGGG - Intronic
926086163 2:10021644-10021666 TTTAACAAGCAGCTCTCGCAGGG + Intergenic
927076007 2:19578368-19578390 GATGAAAAGCATCCCTGGCAGGG - Intergenic
927221611 2:20715660-20715682 GCTGACAAGCAGCTTCAGCAAGG + Intronic
927993264 2:27463170-27463192 GCAGAAAAGCACCTATGGCATGG + Exonic
928282964 2:29964721-29964743 GCTGACCAGCAGCTCTGCGTTGG - Intergenic
930987287 2:57605793-57605815 GCTGATAAGCAACTTTGGCAAGG - Intergenic
932790609 2:74651738-74651760 GCTGAGAAGCAGCTTAGGAAAGG + Intergenic
934579883 2:95429453-95429475 GCTGAGAACCAGTTCTGGGAAGG + Intergenic
934599564 2:95647272-95647294 GCTGAGAACCAGTTCTGGGAAGG - Intergenic
939404268 2:141735786-141735808 GCTGACATGCTGCTCTTGCTAGG - Intronic
941261090 2:163298359-163298381 GCAGACAAGCAGCTTGGGCCGGG + Intergenic
943605522 2:189972844-189972866 GCTGATAAGCAACTTTAGCAAGG - Intronic
948363988 2:237442798-237442820 GCTCACAGGCAGCTCTGACTGGG - Intergenic
948980499 2:241492048-241492070 GCTGACAACCTTCTATGGCAGGG - Intronic
1168997021 20:2140910-2140932 GCTGAAAAGCAGTGTTGGCAAGG - Intronic
1171386679 20:24774176-24774198 GGTGACCAGTAGCTCTGGCCAGG + Intergenic
1173579575 20:44137511-44137533 ACTGATAAGGAGCTCTGGGAAGG + Intronic
1174872409 20:54195484-54195506 GTTGACAAACAGCTGTGGCCAGG + Intergenic
1175956456 20:62612103-62612125 GCTGACACGCGGGTCTGGGAGGG + Intergenic
1179316172 21:40246224-40246246 GCAGAAAAGAGGCTCTGGCATGG + Intronic
1180707494 22:17818376-17818398 GCTGTCCAGCAGCTCTGGCCTGG - Exonic
1180717683 22:17882903-17882925 GGTGACAAGCTGCGCTGGCAGGG + Intronic
1181025543 22:20125395-20125417 GATGGCCAGCAGCTCTGGCTTGG - Exonic
1183467946 22:37989493-37989515 GATGACAAGCTCCTCTGTCATGG + Intronic
1184525424 22:45019968-45019990 GCTGACAGGCAGGTCTGGGAGGG + Intergenic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955501198 3:59584721-59584743 GATGACAAGCAGTTCTGGTAGGG + Intergenic
957413712 3:79873671-79873693 GCTAGTAAGCAGCTCAGGCATGG + Intergenic
961808030 3:129503105-129503127 ACTGACAGCCAGCTCTGCCAGGG + Intronic
962852742 3:139319934-139319956 CCTAACAAGGAGTTCTGGCAAGG - Intronic
967102114 3:186224010-186224032 GGTGCCAAGCAGCTCTCCCAAGG - Intronic
968644523 4:1733079-1733101 ACAGACAAGCAGCGCTGGCGAGG - Intronic
969150784 4:5166993-5167015 GCTGACATGCACATGTGGCATGG - Intronic
969217778 4:5735838-5735860 GCTGGGAAGCAGCTCTTTCAGGG - Intronic
971809649 4:31408210-31408232 GCTGAAAAGCAGCTTAGGGATGG - Intergenic
978918639 4:114154401-114154423 GCTGACAAGCACCAAGGGCAAGG - Intergenic
980985722 4:139692399-139692421 GCTGGCAAGCAGCTGAAGCAAGG + Intronic
981531927 4:145761794-145761816 GCTGACAAGCAGCTCTGGCAAGG + Intronic
981929627 4:150175587-150175609 GTTGACAACAAGCCCTGGCAGGG - Intronic
982035593 4:151342838-151342860 GCTGAGAAGGAGCTGTGGCTAGG + Intergenic
982999155 4:162389706-162389728 GCAGACCAGCAGCTGTGGCTGGG + Intergenic
987667763 5:20966791-20966813 GCTCAAAAGCACTTCTGGCAAGG - Intergenic
989255769 5:39364457-39364479 GCTGACATGCTGCTCTTGCTGGG + Exonic
993622636 5:90186873-90186895 ACGGACAAGCAGCTCTGGGAAGG + Intergenic
994449901 5:99929153-99929175 GCAGAGAAGCAGCCCTGGAATGG + Intergenic
999772584 5:154786724-154786746 GCTGTTGAGGAGCTCTGGCAAGG + Intronic
1003963626 6:11232623-11232645 ACTGACAAGCGGCTCTGCCCGGG - Exonic
1006499569 6:34449207-34449229 GCTGGCTAGGAGCACTGGCAAGG + Intergenic
1007270773 6:40635337-40635359 GCTAAGGATCAGCTCTGGCAGGG + Intergenic
1010977826 6:82336570-82336592 GCTGACAAGGAGCTCTTACTTGG + Intergenic
1013705562 6:112829862-112829884 ACTGACAAGCAGCAGTGGAAAGG - Intergenic
1014211176 6:118709781-118709803 CCTGATAAGCAGCCCTGTCAGGG - Intronic
1014255559 6:119157430-119157452 GGTGGCAAGCAGCGCTGGCCAGG - Intergenic
1019568827 7:1698682-1698704 GCTGACAAGCTTCTCTTGCATGG - Intronic
1021141583 7:17032337-17032359 GCTGACAAACCAGTCTGGCATGG + Intergenic
1023306158 7:38830010-38830032 GCTGATTAACAGCTGTGGCAGGG - Intronic
1024497868 7:50068947-50068969 GCTGAGAAGCAGTTCTGCAAAGG - Intronic
1024692592 7:51819071-51819093 GCTGCCAGGCTGCGCTGGCATGG + Intergenic
1026908805 7:74080616-74080638 GCTGACAAGGAGCTCCTACAAGG + Intergenic
1029905571 7:104089888-104089910 GCTGAAAAGATGTTCTGGCAGGG - Intergenic
1030067830 7:105674005-105674027 GCTCACAAGCACTCCTGGCATGG - Intronic
1030460195 7:109825787-109825809 GCAGGCAAGTAGCACTGGCAAGG + Intergenic
1030742807 7:113129853-113129875 GCTTACAGGGAGCTCTGGAAAGG + Intergenic
1031811798 7:126378961-126378983 GATGACAAAAAGCTCTGACATGG + Intergenic
1032541315 7:132705453-132705475 TCTGAAAAGCAGCTCTAGAAGGG + Intronic
1032730706 7:134640009-134640031 GCTGACTAGCATCTGTGGCCTGG + Intergenic
1032846280 7:135754481-135754503 GCAGACAAGAAGGTCTGGCCAGG + Intergenic
1032934264 7:136711103-136711125 CCTGTCAATCAGCTTTGGCATGG - Intergenic
1033622632 7:143075961-143075983 GCAGACAAGCAGCTCTCAGAAGG + Intergenic
1034927437 7:155133500-155133522 GCTGACCGTCAGCTCTGCCAGGG + Intergenic
1036176025 8:6539304-6539326 GATGGCAAGTAGCTTTGGCATGG - Intronic
1042954209 8:74231161-74231183 GCTGACAAGGAGCTATGGTCAGG + Intergenic
1044117853 8:88356288-88356310 GCTGAGAAGCTGCTGTGGCCTGG - Intergenic
1044820530 8:96153105-96153127 TCTGACAAGCAGTGCTGGCTGGG + Intronic
1045273138 8:100678995-100679017 GCTGGCAAGCATTTGTGGCATGG - Intergenic
1048952483 8:139507948-139507970 GGTGACAAGTGGCACTGGCAAGG + Intergenic
1049653819 8:143789097-143789119 GCTGGCAAGGGGCGCTGGCAGGG + Intergenic
1051872405 9:21753878-21753900 GTTTACAAGGAGCTCTGTCAAGG - Intergenic
1056146218 9:83732087-83732109 CTTGACAAACAGCTCTGTCAAGG - Intergenic
1057949997 9:99362169-99362191 GCTGACAAGCAAGTCTGCAATGG + Intergenic
1060408252 9:123383301-123383323 TCTGCCAAGGAGCCCTGGCAGGG + Intronic
1060566658 9:124598897-124598919 GATGGCCAGCAGCTCTGGCTTGG + Intronic
1061343446 9:130002475-130002497 TCTAACAACCAGCTCTGGCCAGG - Intronic
1061479500 9:130890052-130890074 GATGTCAAGCAGCTCGGCCAAGG + Intergenic
1061515521 9:131087791-131087813 CCTGGCAAGCAGCTCTGACAAGG - Exonic
1061574550 9:131497835-131497857 GCAGACAAGAAGCTCAGGTAGGG - Exonic
1062449597 9:136609949-136609971 ACTGGCAAGCACTTCTGGCAGGG - Intergenic
1187263582 X:17709905-17709927 TCTGACTAGCATCTCTGACAGGG + Intronic
1188064788 X:25645908-25645930 GATGGCCAGCAGCTCTGGCTTGG + Intergenic
1189204352 X:39225143-39225165 TTTAACAACCAGCTCTGGCATGG + Intergenic
1189916486 X:45860668-45860690 GGAGCCCAGCAGCTCTGGCAGGG + Intergenic
1189982211 X:46522143-46522165 TCTGACAAGCAGAAGTGGCACGG + Intronic
1190969511 X:55335035-55335057 GCTGATATGCAGCTCTGACATGG + Intergenic
1192168605 X:68840986-68841008 GCGGACAAGCAGTCCTGGGAAGG - Exonic
1194607997 X:96005673-96005695 CCTGAGAAGCTGCTCTGCCAAGG - Intergenic
1196101767 X:111854180-111854202 GTTTACAGTCAGCTCTGGCAAGG + Intronic
1196561616 X:117155962-117155984 GCTGATAAGCAGCTTCAGCAGGG + Intergenic
1197309213 X:124883613-124883635 GCTGGCCAGCAGGTGTGGCATGG + Intronic
1198000743 X:132433282-132433304 CCTGACAAGCTGTTATGGCATGG + Intronic
1200337922 X:155369523-155369545 GCCAACCAGCAGCTCTGGGAAGG - Intergenic
1200348548 X:155471703-155471725 GCCAACCAGCAGCTCTGGGAAGG + Intergenic
1201279399 Y:12328022-12328044 CCTGACATGCAGTTCTGTCAGGG - Intergenic