ID: 981542758

View in Genome Browser
Species Human (GRCh38)
Location 4:145862406-145862428
Sequence ATCTATATGTTACACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981542758_981542765 20 Left 981542758 4:145862406-145862428 CCCTGTTTGTGTAACATATAGAT 0: 1
1: 0
2: 1
3: 13
4: 206
Right 981542765 4:145862449-145862471 AATTCTCACTGAGTTTTCAAGGG No data
981542758_981542764 19 Left 981542758 4:145862406-145862428 CCCTGTTTGTGTAACATATAGAT 0: 1
1: 0
2: 1
3: 13
4: 206
Right 981542764 4:145862448-145862470 CAATTCTCACTGAGTTTTCAAGG 0: 1
1: 0
2: 3
3: 25
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981542758 Original CRISPR ATCTATATGTTACACAAACA GGG (reversed) Intronic