ID: 981542758

View in Genome Browser
Species Human (GRCh38)
Location 4:145862406-145862428
Sequence ATCTATATGTTACACAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981542758_981542764 19 Left 981542758 4:145862406-145862428 CCCTGTTTGTGTAACATATAGAT 0: 1
1: 0
2: 1
3: 13
4: 206
Right 981542764 4:145862448-145862470 CAATTCTCACTGAGTTTTCAAGG 0: 1
1: 0
2: 3
3: 25
4: 261
981542758_981542765 20 Left 981542758 4:145862406-145862428 CCCTGTTTGTGTAACATATAGAT 0: 1
1: 0
2: 1
3: 13
4: 206
Right 981542765 4:145862449-145862471 AATTCTCACTGAGTTTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981542758 Original CRISPR ATCTATATGTTACACAAACA GGG (reversed) Intronic
904546469 1:31277569-31277591 ATATATACAGTACACAAACAAGG + Intronic
907590447 1:55662250-55662272 ATATATATGGTACATATACATGG + Intergenic
907590534 1:55663495-55663517 ATATACATGGTACACAAACATGG + Intergenic
907954802 1:59217833-59217855 ATCAATATATTACCCAAATAAGG + Intergenic
908840370 1:68274258-68274280 ATCCATATGTCACAAATACATGG - Intergenic
909027390 1:70498512-70498534 TTCTATATGTTACACAAATATGG - Intergenic
909667429 1:78150756-78150778 ATCTATAAGATACAAAAACCAGG - Intergenic
909930633 1:81494955-81494977 ATCTATCTGTGTCACAAATATGG - Intronic
911086483 1:93981812-93981834 AAAAATATGTGACACAAACATGG - Intergenic
912166376 1:107046243-107046265 ATATAAATGTTATAAAAACAAGG + Intergenic
915775878 1:158485705-158485727 ATCTATATGGTAAAAAACCAAGG - Intergenic
916266183 1:162891883-162891905 ATCTCTATGTTAAACATACCTGG + Intergenic
916692039 1:167199437-167199459 ATGTATATGTTACACAGATAGGG - Intergenic
917661878 1:177184856-177184878 ATGTATATGTTACAAAATTAGGG + Intronic
917690718 1:177465656-177465678 CTCTATAAGTTACTCAAACTCGG - Intergenic
918724080 1:187895175-187895197 CTCGATATGTTAGACAAACTTGG - Intergenic
918996438 1:191766997-191767019 ATTTATATGTTAAAAAAGCATGG - Intergenic
919176680 1:194028089-194028111 ATATATATGATACAAAATCATGG - Intergenic
922952039 1:229566904-229566926 ACCTATATATTACAGAAAAAAGG + Intergenic
923135792 1:231117538-231117560 GTCTGTAGGTTACACAAGCATGG - Intergenic
923661189 1:235958873-235958895 ATCTATATGCTAGAGAAGCAAGG - Intergenic
923762059 1:236855858-236855880 TTCTCCATGATACACAAACAAGG - Intronic
1063000891 10:1921230-1921252 ATGTATATATTACATAAATAAGG + Intergenic
1068033832 10:51735810-51735832 ATCCATGGGTTACACAACCAGGG - Intronic
1068344780 10:55761418-55761440 ATTTATACGTTTCACAAACGGGG + Intergenic
1068729945 10:60346277-60346299 TTCTATATGGCACACAAAAAAGG + Intronic
1068748194 10:60559548-60559570 ATCCCTATTTTACAGAAACAAGG + Intronic
1070366874 10:75745280-75745302 ATTTATATTATACACACACACGG - Intronic
1075180012 10:120202560-120202582 GTCTATATGTTCCACATAAAAGG - Intergenic
1079193137 11:18298676-18298698 ATCTGTAGGTCACACAGACAGGG + Intronic
1080358385 11:31480981-31481003 AATTATAAATTACACAAACATGG + Intronic
1081134946 11:39429015-39429037 ATATATATGTTACATAAAAAAGG - Intergenic
1081243899 11:40739990-40740012 ATATATATTTTATACAAATATGG + Intronic
1081302837 11:41474039-41474061 ATCTCTGTGTTCCACATACATGG - Intergenic
1081419471 11:42856477-42856499 ATCAATATGGGACAAAAACAAGG + Intergenic
1081828799 11:46087633-46087655 ATTTATAGTTTACAAAAACAAGG + Intronic
1085089158 11:73695075-73695097 ATCTATATATTTAACAAACTTGG + Intronic
1087536480 11:99453174-99453196 ATCAATATCTTAATCAAACATGG - Intronic
1091861970 12:3793641-3793663 ATCTATACGTTAAAAAAATATGG - Intronic
1092175880 12:6406476-6406498 TTCTATAAGTTATACAAAAAGGG - Intergenic
1094801186 12:34037797-34037819 ATGTATACATTACACACACACGG - Intergenic
1095313039 12:40723688-40723710 AGCAATAAGTTACAAAAACAGGG + Intronic
1096851280 12:54439379-54439401 ATCTAAAAGTGACACAAACCGGG - Intergenic
1098783883 12:74723964-74723986 AGCTTTATGTATCACAAACATGG - Intergenic
1099026281 12:77468430-77468452 GTGTATATATGACACAAACATGG - Intergenic
1099343027 12:81462240-81462262 ATATATATGTTAGAAAAGCATGG - Intronic
1099554604 12:84095869-84095891 ATCTATATTTTACAACACCAAGG - Intergenic
1106108438 13:26756121-26756143 AACTATATGTTTTAAAAACATGG + Exonic
1107979134 13:45717508-45717530 AAATATTTGTAACACAAACATGG - Intergenic
1108253070 13:48586173-48586195 ATTTATCAGTTACACATACAAGG + Intergenic
1109388588 13:61665520-61665542 AAGTAGAGGTTACACAAACAAGG + Intergenic
1109469585 13:62788165-62788187 ATTGAGAGGTTACACAAACAGGG - Intergenic
1109605271 13:64686384-64686406 ATATATATGTCACTCAAAAATGG + Intergenic
1109611266 13:64767846-64767868 ATCTATATTTTACAAAAATAAGG - Intergenic
1110370853 13:74738372-74738394 ATTTATGTGTTACACAAGGATGG + Intergenic
1112302693 13:98244631-98244653 CTCTATTTCTTACACAAACTGGG + Intronic
1115274281 14:31590039-31590061 ACCTGTATGTTACACATAAAGGG - Intronic
1116148700 14:41108964-41108986 AACTATATTTTACACAAAATAGG - Intergenic
1117253777 14:53957923-53957945 ATCTCTCTGTTTTACAAACAAGG + Intronic
1118252521 14:64175947-64175969 ATCATTATGCTTCACAAACATGG - Intronic
1118485636 14:66212234-66212256 ATGTATATTTCACACATACATGG - Intergenic
1119588210 14:75858535-75858557 ATCTATCTGATAGACAAACTAGG + Intronic
1126969065 15:54089176-54089198 AACTCCATGTTACACACACAGGG - Intronic
1127390107 15:58498506-58498528 ATATATACAGTACACAAACAGGG + Intronic
1129529323 15:76250340-76250362 ATTTGTATGGTACACGAACAAGG + Intronic
1130105567 15:80926125-80926147 ATTTATATGTTTGAGAAACATGG - Intronic
1144277464 17:13687538-13687560 ATAGATATGTTTCACACACATGG - Intergenic
1148256370 17:46136144-46136166 CTCTATATGCTAATCAAACAGGG + Intronic
1154109492 18:11553623-11553645 ATCTCTATGTTAAATAAAGAGGG - Intergenic
1156222722 18:35069686-35069708 ATATATATATTCCACAAACTAGG + Intronic
1156538300 18:37885000-37885022 TTATATATGGTACAAAAACAAGG - Intergenic
1156983227 18:43318102-43318124 ATTTATAAATTACATAAACATGG + Intergenic
1159169616 18:64748652-64748674 ATTAACATTTTACACAAACATGG - Intergenic
1159602432 18:70441483-70441505 ATTTATTTTTTACACAAATATGG - Intergenic
1159982609 18:74803740-74803762 ATTTATATGTTTTACAAACCAGG + Intronic
1163031412 19:14546560-14546582 ATTTATTTATTACAGAAACAGGG + Intronic
1164203279 19:23036252-23036274 AAGCATATGTTACAGAAACATGG - Intergenic
1164755725 19:30687647-30687669 ATCTATATGTCAGGGAAACAGGG + Intronic
1165336183 19:35171257-35171279 ATGTATATTATACACATACAGGG + Intergenic
1165675381 19:37718478-37718500 ATTTACATGTTTAACAAACACGG - Intronic
1165837616 19:38769378-38769400 AACTATGTTTTCCACAAACAGGG + Intronic
1165841942 19:38793321-38793343 AACTCTATTTTCCACAAACAGGG - Intergenic
1166265001 19:41675322-41675344 ATCTATAGCTTACAGAAACTTGG - Intronic
1167328852 19:48841638-48841660 ATATATATGTTGCTTAAACAAGG + Intronic
1168572125 19:57479983-57480005 CTTTCTATGTTAGACAAACAAGG + Intergenic
926439965 2:12877867-12877889 ATCTGTATGTTTCACATAAATGG - Intergenic
926654370 2:15384475-15384497 ATCTTTATGCTATACAAAAAGGG - Intronic
929016955 2:37507172-37507194 ATCAATATTTCACACAAAGAAGG + Intergenic
929766640 2:44849185-44849207 AGCTAAATGTGGCACAAACAAGG - Intergenic
930384466 2:50676267-50676289 TTCTATAGGTTATACAAGCATGG - Intronic
930858989 2:56050275-56050297 ATTTATACTTCACACAAACAAGG - Intergenic
931191863 2:60009256-60009278 ATCTATGTGTTACAAAAATGTGG - Intergenic
931757820 2:65389419-65389441 ATCTATATGTTTCTCAAAAGTGG - Intronic
937482029 2:122271742-122271764 TTTTATATCTAACACAAACACGG - Intergenic
938845086 2:135200254-135200276 CTCGATATATTAAACAAACATGG + Exonic
939678369 2:145100122-145100144 ATCTCTATGTTACACTGAAAAGG + Intergenic
940092447 2:149935980-149936002 ATGTATTTTTTAAACAAACATGG + Intergenic
941063034 2:160869430-160869452 ATCTATTTGTCAAATAAACAGGG - Intergenic
945367752 2:208977572-208977594 AACTTTATGTTTAACAAACATGG - Intergenic
945638103 2:212384878-212384900 ATATATATATTCCACAAACATGG - Intronic
946040287 2:216777043-216777065 ATCTCTTTGTTACACACAGAGGG - Intergenic
946762576 2:223009476-223009498 AACTATATTATACACACACATGG - Intergenic
1169681694 20:8221490-8221512 TTCTATATGTTTCACAATAAAGG + Intronic
1170365537 20:15594170-15594192 AACTATAATTTACACAAATATGG + Intronic
1172678102 20:36689620-36689642 AAGTTTATGTTCCACAAACATGG - Intronic
1177325435 21:19582028-19582050 ATCTATATTATACACTTACATGG + Intergenic
1177912735 21:27052630-27052652 ATATATATGAAAAACAAACAAGG + Intergenic
1179562563 21:42225044-42225066 TTTAATATGTTAGACAAACAAGG - Intronic
1181337015 22:22144073-22144095 ATCCATATGTTACTCAATCCTGG - Intergenic
1181850168 22:25744124-25744146 ATTTCCATGTTTCACAAACATGG + Intronic
957302075 3:78405193-78405215 AACTAAATGTTCCACAAACTGGG - Intergenic
957319422 3:78610083-78610105 ATTTATATGATACTCGAACATGG - Intronic
957744784 3:84325505-84325527 ATGTGTATTTTACACAATCATGG + Intergenic
958028607 3:88078954-88078976 ATTTATAGGTGACACAAACTGGG + Intronic
958092946 3:88900881-88900903 ATCCACATGTTTCATAAACAGGG - Intergenic
959510891 3:107210640-107210662 ATCCATAGGTTACTCTAACAAGG - Intergenic
961444050 3:126970438-126970460 ATGATTATGTTACACATACAAGG - Intergenic
962008764 3:131373383-131373405 ATCAATATGTTACCAATACATGG + Intergenic
963178555 3:142328763-142328785 ATATATATGTTTCAGAGACAAGG + Intronic
963304254 3:143632828-143632850 ATGTAACTGTTCCACAAACATGG + Intronic
964200235 3:154110853-154110875 ATCTATATATAAAACCAACATGG + Intergenic
965701715 3:171464989-171465011 ATCTATATGTTTTACACACATGG - Intergenic
965879637 3:173372996-173373018 ATCAAAATGTTCAACAAACAGGG + Intergenic
966212923 3:177471311-177471333 ATCCATATGTGACACCAATAGGG - Intergenic
966568348 3:181409051-181409073 ATCTATCTGCTGCAGAAACAGGG - Intergenic
969838438 4:9862438-9862460 ATGTATATTTCACACATACATGG - Intronic
970833992 4:20378409-20378431 ATCCTTTTGATACACAAACAAGG + Intronic
971630506 4:28987299-28987321 ATATATATATTACACACACTTGG + Intergenic
972211704 4:36846433-36846455 ATCAATGTGTTAAACAAAAATGG + Intergenic
974071177 4:57125736-57125758 ATGTTTATCTTACACAAACTTGG + Intergenic
974108703 4:57500792-57500814 CTCAATATAGTACACAAACATGG - Intergenic
974233048 4:59142212-59142234 AACTTTATGTTACTCAAAAATGG + Intergenic
977858506 4:101926474-101926496 ATCTATTTGTTAAACTAAAATGG - Intronic
978000261 4:103548661-103548683 ATCTGTGGGTTCCACAAACATGG - Intergenic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
981542758 4:145862406-145862428 ATCTATATGTTACACAAACAGGG - Intronic
981961938 4:150551821-150551843 ATATATTTTTTACACACACACGG + Intronic
982439622 4:155420405-155420427 ATCTAAATGTAACAAATACATGG - Intergenic
984317915 4:178151880-178151902 ATCTATATTCTAAACAATCATGG - Intergenic
989792256 5:45419953-45419975 ACCTATATGCTACACAGGCAGGG - Intronic
990027675 5:51214996-51215018 ATCTATATGTTAGGCTAGCATGG - Intergenic
991960822 5:72042462-72042484 ATATATATGTTTTACAAACAGGG + Intergenic
991961351 5:72047659-72047681 ATTAATATTTTACACATACATGG - Intergenic
992527290 5:77624331-77624353 GTCTATATGTTACATACACAAGG + Intergenic
992650740 5:78857045-78857067 ATCTATATTTTACAATAAAAGGG - Intronic
992806333 5:80341738-80341760 AGGTATATGTTAAAGAAACATGG + Intergenic
993208375 5:84916180-84916202 ATATATATTTTATACAAACAAGG - Intergenic
994603049 5:101932351-101932373 ATCTATCTGTATTACAAACATGG + Intergenic
995990964 5:118239317-118239339 ATGTATATACTCCACAAACAGGG - Intergenic
996237440 5:121149161-121149183 ATCTATATGAAAAACAAATATGG - Intergenic
996991575 5:129639180-129639202 GTCCATATGTTACACAGGCAAGG - Intronic
998283705 5:140837384-140837406 ATATATTTCTTATACAAACAAGG - Intronic
998536175 5:142932908-142932930 AGCCATATTTTATACAAACATGG + Intronic
998609273 5:143670492-143670514 TTCTATAGGCTACACAAACATGG + Intergenic
1003703439 6:8496343-8496365 ATTTACATTTTACACCAACAGGG + Intergenic
1008052480 6:46914395-46914417 ATATTTATTTAACACAAACATGG + Intronic
1008372422 6:50748204-50748226 ATTCATATGTTGCACAAAAAGGG - Intronic
1008481536 6:51990988-51991010 ATTTATATGTGACAGACACATGG - Intronic
1009560761 6:65239945-65239967 ATATATATGCTACAAATACATGG - Intronic
1010091792 6:71991636-71991658 CTTTATATGTTACATTAACAAGG + Intronic
1010340464 6:74745479-74745501 AGATATATATTATACAAACATGG + Intergenic
1010921382 6:81685868-81685890 ATCTATATATTCCAGCAACAGGG + Intronic
1011889916 6:92145307-92145329 TTCAAAATGTTACACAAATACGG - Intergenic
1012162709 6:95906848-95906870 GTAAATATGTCACACAAACATGG + Intergenic
1012652596 6:101775093-101775115 ATGTTTATCTTACACAAATACGG - Intronic
1013739183 6:113263584-113263606 ATCTATAATCTACAGAAACAAGG - Intergenic
1016883401 6:148933973-148933995 ATGAATATATTCCACAAACAAGG + Intronic
1017058703 6:150460637-150460659 ATTTTTATGTTTTACAAACAAGG + Intergenic
1017562281 6:155641288-155641310 ATATCTATGTAACACAAAGAAGG - Intergenic
1019837626 7:3405590-3405612 ATCTACATGTTACTCCAGCATGG - Intronic
1021545240 7:21805690-21805712 TGCTATATGTTAGACACACATGG - Intronic
1021980301 7:26047746-26047768 ATTTATTTCTTACAAAAACAAGG - Intergenic
1022065145 7:26847219-26847241 ATCTATATGCTATATATACAGGG + Intronic
1022850256 7:34254245-34254267 ATATATGTTTTACACATACATGG + Intergenic
1023762347 7:43478085-43478107 ATATATATGGTACTCAGACATGG + Intronic
1025921828 7:65920480-65920502 ATCTATATGTTAATCAATAACGG - Intronic
1029089050 7:98033804-98033826 GTCTAAATGTTCCAGAAACATGG - Intergenic
1030232070 7:107218976-107218998 ATCTATACGGAACACAAAAATGG + Intronic
1035775603 8:2185400-2185422 ATATATATTTTACAGAAGCACGG - Intergenic
1037318990 8:17626538-17626560 ATCTAACTGTGACACAAAGAAGG + Intronic
1037336382 8:17796503-17796525 ATATAAATGTTACACAATCAAGG - Intronic
1037353806 8:17995964-17995986 ATATATATCATATACAAACAAGG + Intronic
1037602395 8:20408339-20408361 TTCTATGTGTTTCACAAACTTGG + Intergenic
1038479714 8:27893456-27893478 ATATATATGTCAGACAAGCAAGG + Intronic
1039209018 8:35190348-35190370 ATATATATCTTACATAAACTGGG - Intergenic
1041169027 8:55121791-55121813 ATTTTTATGTTACAGAAAAAAGG + Intronic
1041240556 8:55845608-55845630 ATCTATAGTTTAAACAAAGACGG - Intergenic
1042140117 8:65669326-65669348 ATTTATAGGCTACACAACCAAGG - Intronic
1044134799 8:88573170-88573192 ATCAATATGTTCCACAAAATGGG - Intergenic
1046200952 8:110927035-110927057 ATATATAGGTAACTCAAACATGG + Intergenic
1046348134 8:112964168-112964190 ATCTATATGTTAATAAAATATGG + Intronic
1050137513 9:2482350-2482372 ATCTATATTTTACGCAGAGATGG - Intergenic
1051002377 9:12299804-12299826 TTCTATATTTAACAGAAACAAGG + Intergenic
1052343632 9:27386604-27386626 CTATATATGTAGCACAAACAGGG + Intronic
1052555972 9:30018050-30018072 ATTTATATGCTACACATTCAGGG + Intergenic
1054817302 9:69487353-69487375 ACCTATAAGTTACAAATACAGGG + Intronic
1054862129 9:69964874-69964896 ATGTATATTTTACATATACATGG + Intergenic
1054961969 9:70979303-70979325 GCCTATATGTGACACAGACATGG + Intronic
1058270169 9:102962400-102962422 ATTTATAAGTTACAAAAAGAAGG - Intergenic
1058347070 9:103976960-103976982 ATCTATTTGTTATACGCACATGG - Intergenic
1058371561 9:104274907-104274929 ATATATATGTTACATATATATGG + Intergenic
1059217310 9:112576570-112576592 TTCTATATGTTTCATATACATGG + Intronic
1186025172 X:5302561-5302583 ATATATATGGTACACATATATGG - Intergenic
1186025174 X:5302591-5302613 ATATATATGGTACACATATATGG - Intergenic
1186025176 X:5302621-5302643 ATATATATGGTACACATATATGG - Intergenic
1186025178 X:5302651-5302673 ATATATATGGTACACATATATGG - Intergenic
1186392217 X:9172549-9172571 ATCTATACGTTAACCACACAAGG - Intergenic
1187195031 X:17075057-17075079 ATCTGTATCTTACATAAACAAGG - Intronic
1187915956 X:24152020-24152042 ATTTCTATGGTACACAAATAGGG + Intronic
1188264172 X:28050067-28050089 ATATATATATTATAAAAACATGG - Intergenic
1188446726 X:30260791-30260813 ATATATATTTTACAGAGACATGG - Intergenic
1189245367 X:39559215-39559237 TTCTAAGTGTTACAGAAACAAGG - Intergenic
1193753235 X:85373329-85373351 ATTTATCTGTTAAACAAATAAGG - Intronic
1194715063 X:97278368-97278390 CTCTATATGTTATACATATATGG + Intronic
1194782425 X:98041019-98041041 ATCTGTATCTGACACCAACATGG + Intergenic
1197383620 X:125776417-125776439 ATATATATGTTACATATGCATGG + Intergenic
1197688100 X:129465617-129465639 ATTTGTATGTTACACAAAATGGG - Exonic
1198989563 X:142496240-142496262 ACCTAAATGTTAGAGAAACATGG + Intergenic
1199201893 X:145100630-145100652 ATATATATGTTACCCATACAAGG + Intergenic
1199265977 X:145825880-145825902 ATCATTATTTTACACTAACATGG + Intergenic
1201535276 Y:15040879-15040901 ATCTATAATTTAAAAAAACATGG - Intergenic