ID: 981543870

View in Genome Browser
Species Human (GRCh38)
Location 4:145874057-145874079
Sequence CTTAATGATCTCTAGAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981543870_981543872 3 Left 981543870 4:145874057-145874079 CCCAACTTCTAGAGATCATTAAG 0: 1
1: 0
2: 0
3: 12
4: 143
Right 981543872 4:145874083-145874105 ATGCTTCCTGCACATGTAAGTGG 0: 1
1: 0
2: 0
3: 7
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981543870 Original CRISPR CTTAATGATCTCTAGAAGTT GGG (reversed) Intronic
900658306 1:3771016-3771038 CTCAAAGATCTCTAGGAGTCTGG + Intronic
901298748 1:8182919-8182941 GTTCATGCTCTCTAGCAGTTTGG + Intergenic
901585988 1:10292956-10292978 GTTGATGATCTCTCTAAGTTAGG + Intronic
905927050 1:41758578-41758600 TTCAATGGTCTCTAGAACTTGGG - Intronic
907471298 1:54675426-54675448 CTTCTTGATCTCTAGCATTTGGG + Intronic
908524402 1:64974217-64974239 CTTGATGTTCTACAGAAGTTGGG - Intergenic
910048355 1:82945717-82945739 GTAAATGTTCTATAGAAGTTTGG + Intergenic
911837965 1:102645465-102645487 CTTCATCTTCTCTAGGAGTTTGG - Intergenic
911837978 1:102645532-102645554 CTTCATCTTCTCTAGGAGTTTGG - Intergenic
915615169 1:157032128-157032150 CTTAAAGATCTCTAGTAGACAGG + Intronic
916285991 1:163106275-163106297 CTTATTGATTTCTAGGTGTTAGG - Intergenic
917506884 1:175635346-175635368 GTGAATGACCTCTAGTAGTTTGG + Intronic
920953835 1:210599285-210599307 TTTAATGTTTTCTAGAAGTGGGG - Intronic
924204591 1:241698703-241698725 CTTAAAGATTTCTGGAGGTTGGG - Intronic
924667398 1:246087355-246087377 CTTAATCATCTCTAGAACCCTGG + Intronic
1063143718 10:3277304-3277326 TTTCATGATCTCTTAAAGTTTGG - Intergenic
1063768757 10:9173573-9173595 CTTAATAATCTCTAAATGTATGG + Intergenic
1065313527 10:24439667-24439689 GTTGATGACCTCTAGAAGTTGGG - Intronic
1070755828 10:78992706-78992728 CTTCATGATCTCCAGCATTTTGG - Intergenic
1073807147 10:107109945-107109967 CCTAAAGATCTGTGGAAGTTTGG - Intronic
1075300946 10:121323655-121323677 TTTCATGGTCTCTTGAAGTTAGG + Intergenic
1075942920 10:126406615-126406637 ATTAATTATTTCTAGAAGTTTGG - Intergenic
1078313592 11:10271947-10271969 CTGAAATATCTCTAAAAGTTAGG + Intronic
1079633162 11:22702708-22702730 CTTAATGTTCTCTACATATTGGG + Intronic
1080063385 11:27981347-27981369 CTTAATCCTCTCTAGGAGTGAGG - Intergenic
1080987061 11:37481701-37481723 CATAATAATCTCTGGAATTTGGG + Intergenic
1081086457 11:38807848-38807870 CTTAATGGTATCTAGAATGTTGG - Intergenic
1081277553 11:41168520-41168542 CTTAATGATAACTAAAACTTGGG + Intronic
1085962274 11:81476109-81476131 TTTAATGATTTCTAGAAAATTGG + Intergenic
1094465336 12:30747789-30747811 CTTAATGACATCTAGAATGTAGG - Intronic
1095858988 12:46893638-46893660 CTTAAATGTCTCTAGAAGCTTGG - Intergenic
1099002043 12:77189880-77189902 CTTAACGTTCTCTAGTATTTTGG + Intergenic
1104142625 12:126003505-126003527 CTTAGGGATCTGTAGAAGTTTGG + Intergenic
1108409953 13:50135397-50135419 CTTTATGCTCTCAGGAAGTTGGG + Intronic
1111377822 13:87403522-87403544 ATTAATGATGTCAAAAAGTTTGG - Intergenic
1115828806 14:37310893-37310915 CTTAAAGACCTGTAGAAGTTTGG + Intronic
1116491104 14:45503981-45504003 CATATTGACCTTTAGAAGTTTGG - Intergenic
1118656222 14:67952524-67952546 CTAAATGACATCTTGAAGTTTGG + Intronic
1122572766 14:102718754-102718776 CTTAATAAACACTAGATGTTTGG + Intronic
1126607396 15:50492353-50492375 TTAAATGATCCCTGGAAGTTTGG - Intronic
1127409069 15:58686704-58686726 CTGAAATATCTCTAAAAGTTAGG - Intronic
1129904307 15:79175297-79175319 TTAAATGATCTCTAGAACATTGG - Intergenic
1135481981 16:22828214-22828236 CTCAAAGATCTCTAGAAATGAGG - Intronic
1137285237 16:47010232-47010254 CAGAATGATCTCTAGGAGCTGGG - Intergenic
1144132982 17:12265979-12266001 CTTCATAATCTCTTGAACTTGGG - Intergenic
1146748519 17:35353922-35353944 TTTGATCTTCTCTAGAAGTTGGG - Exonic
1147381613 17:40059708-40059730 CTTACACATCTCTAGCAGTTTGG - Intronic
1152918519 17:83053771-83053793 CTTCATGTTCTCCAGAGGTTGGG + Intergenic
1203190393 17_KI270729v1_random:179956-179978 GTTTATGATCTTTAGATGTTGGG - Intergenic
1155062430 18:22240753-22240775 CTTAAGGATCTCTACAATTATGG - Intergenic
1156167735 18:34443523-34443545 TATAAAGATCTGTAGAAGTTGGG - Intergenic
1156800203 18:41101860-41101882 TTTAATGATCTCCATCAGTTAGG + Intergenic
1159402399 18:67955047-67955069 CTTAATGATCTCTACATATGCGG + Intergenic
1160085204 18:75770975-75770997 CTTAAAGATCTATAAAAGTGTGG + Intergenic
1161351026 19:3791769-3791791 CTCAGTGATCTCTAGGAATTTGG - Intronic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
1167237313 19:48322661-48322683 ATTCAGGATCTCTAGGAGTTGGG - Intronic
926372649 2:12195975-12195997 CTTACTGAACTCTACAAGATGGG - Intergenic
926547157 2:14255792-14255814 CTTAATGATCTTGAGACTTTAGG + Intergenic
927073518 2:19553621-19553643 TTAAATGTTCTCTAGAATTTGGG - Intergenic
928870902 2:35977514-35977536 CTTAATGATGGCTAATAGTTTGG - Intergenic
932023848 2:68114388-68114410 CTTCATGAACTCTAGATCTTTGG - Intergenic
932915051 2:75848240-75848262 CAAAATGCTCTCTAGAATTTGGG + Intergenic
932940327 2:76157168-76157190 TTTCATGAACTTTAGAAGTTAGG + Intergenic
933283459 2:80357987-80358009 CTTCATGAAGACTAGAAGTTAGG - Intronic
934819496 2:97359941-97359963 CCCAATCATCTCTAGAAATTGGG + Intergenic
935645775 2:105333001-105333023 AATAATGTGCTCTAGAAGTTTGG + Intergenic
936417905 2:112336145-112336167 ATTAATGGCCACTAGAAGTTAGG + Exonic
938936695 2:136133482-136133504 CTTAATGATCACTGGGACTTGGG + Intergenic
940254220 2:151712298-151712320 CTTAATGAGGTCTAAATGTTGGG + Intronic
941201778 2:162520530-162520552 CATAATGATCTCTTGAGGTCAGG + Intronic
942893717 2:181023150-181023172 CTTAATGATTTTCAGATGTTAGG - Intronic
946450299 2:219773915-219773937 CATAATCCTCTCAAGAAGTTTGG - Intergenic
947286274 2:228518814-228518836 CTTTTCTATCTCTAGAAGTTTGG + Intergenic
1169828669 20:9797970-9797992 CTAAATGGTCTCTACAGGTTGGG - Intronic
1171515742 20:25732627-25732649 CTTAATGTTCTCTAAATATTAGG - Intergenic
1173411457 20:42814049-42814071 CTTGATTTTCTCTAGATGTTTGG + Intronic
1173981707 20:47229399-47229421 CTGAATCTTCTCTGGAAGTTTGG - Intronic
1174895709 20:54447810-54447832 CTAAATGATATCTAGAAAGTGGG + Intergenic
1174964745 20:55199741-55199763 CTGAATGAACTCTGGAAGCTGGG - Intergenic
1175555985 20:59857250-59857272 CTTAGGGATCTGTGGAAGTTTGG + Intergenic
1176916359 21:14630290-14630312 CTTCCTGATCTATAGTAGTTCGG + Intronic
1177790234 21:25714951-25714973 AGTAACGTTCTCTAGAAGTTAGG - Intronic
1177925779 21:27212897-27212919 TTTAATGAGCTGTTGAAGTTGGG + Intergenic
1178086801 21:29120388-29120410 CTTTATGAGCTCTGGAACTTTGG + Intronic
1183217875 22:36492869-36492891 CTCAATGATCTCATGAAGTTTGG + Intronic
950584797 3:13884443-13884465 CATAAAGATCTCTGGATGTTAGG - Intergenic
951416686 3:22432626-22432648 CTTAATGGTCCCTATAAGTATGG + Intergenic
951665658 3:25120675-25120697 CTTAATGATATCCAGAATTTGGG + Intergenic
957587229 3:82147799-82147821 TTTAATTGTCTCTAGAAGGTAGG + Intergenic
958648679 3:96906928-96906950 ATAAATGATCTCTGGAATTTCGG + Intronic
960449564 3:117789948-117789970 CTTGCTGGTCTCTAGAAGTGGGG - Intergenic
964780453 3:160331515-160331537 CTTAATGACATATTGAAGTTGGG - Intronic
970035729 4:11733682-11733704 CTTAATGATCTCTGGGGGATAGG + Intergenic
970133101 4:12892759-12892781 CTAAATAATCTCTAGCACTTTGG - Intergenic
970268469 4:14316591-14316613 TTTATTTATCTCTAGAAGTTAGG + Intergenic
970297513 4:14646500-14646522 CTTCATGAACTCTAGAAGATGGG + Intergenic
972046463 4:34671126-34671148 CTTAATGATCTCTATGATTTTGG + Intergenic
972913609 4:43849007-43849029 TTTAAGAATCTCTAGAAATTAGG - Intergenic
973995898 4:56458167-56458189 CATAATGATCACTAGAATTGGGG + Intronic
975115398 4:70675125-70675147 CTTAATCAGCTCTAAAAATTAGG + Intronic
976064207 4:81165090-81165112 CTTAATGAACTCTAGTATGTTGG + Intronic
979971196 4:127137553-127137575 CTTAATGATCTGTAATTGTTAGG - Intergenic
980996120 4:139781411-139781433 CTTCATGATATTTAAAAGTTTGG + Intronic
981543870 4:145874057-145874079 CTTAATGATCTCTAGAAGTTGGG - Intronic
988848664 5:35156785-35156807 CAGAATGTTGTCTAGAAGTTTGG - Intronic
989171931 5:38479905-38479927 CTTTATGATCTGTGGAAATTTGG - Exonic
990171117 5:53050719-53050741 CTTATTGATCTCTAGGATTAGGG + Intronic
996063617 5:119057996-119058018 ATTAATGATCTATATAAATTAGG + Intronic
997346282 5:133194862-133194884 TTTTATGATCTCTATAATTTTGG + Intergenic
998863117 5:146465255-146465277 CTGAGTGATCTCAAGGAGTTGGG + Intronic
999360060 5:150976656-150976678 ATTGATGATATCCAGAAGTTGGG + Intergenic
1007921961 6:45618309-45618331 CCTAATGATCCCCAAAAGTTTGG - Intronic
1009707265 6:67267489-67267511 CTGAATGCTCTCTAAAAATTTGG - Intergenic
1010925510 6:81740558-81740580 CTTAATGATACCTAAAGGTTAGG + Intronic
1011951287 6:92968293-92968315 CTTAATAATCTCTTGATGTTTGG + Intergenic
1016290196 6:142520057-142520079 CATAATTACCTCTAGAAGTTTGG - Intergenic
1018344493 6:162886811-162886833 ATTAATGATATCTAGAATTTTGG - Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1020705507 7:11538868-11538890 CTTAATGATCACTGGGAGTCTGG + Intronic
1021305547 7:19027446-19027468 CTTATTTATTTGTAGAAGTTTGG + Intronic
1023015279 7:35962844-35962866 CATAAAGATGTCTAGAAGTGAGG + Intergenic
1026770007 7:73190192-73190214 CTGAATGAAGTATAGAAGTTCGG + Intergenic
1027010875 7:74743575-74743597 CTGAATGAAGTATAGAAGTTCGG + Intronic
1027077167 7:75202465-75202487 CTGAATGAAGTATAGAAGTTCGG - Intergenic
1035216800 7:157373663-157373685 GTTAATGAGAGCTAGAAGTTAGG + Intronic
1036285409 8:7440847-7440869 CTTAATGTTCTCTGGAGCTTGGG + Intergenic
1036336067 8:7870682-7870704 CTTAATGTTCTCTGGAGCTTGGG - Intergenic
1037455291 8:19057489-19057511 TTCAATGATCTCTACTAGTTTGG + Intronic
1040876935 8:52163443-52163465 CTTGGTGATATCTAGAAATTTGG - Intronic
1042425005 8:68637399-68637421 CTTGATGATCTATAGAATTAGGG + Intronic
1043055765 8:75435905-75435927 TTTAATGTTCTATAGAAGATAGG + Intronic
1043346325 8:79302836-79302858 CTTTATGATCTCTAAAAATAAGG - Intergenic
1043971291 8:86531534-86531556 CTTAATAATCTGTATCAGTTTGG + Intronic
1044205719 8:89490283-89490305 CCTAAAGATCTGTAGAATTTTGG + Intergenic
1044621620 8:94196109-94196131 CTTTATTATCTCTAGAGATTAGG + Intronic
1046137184 8:110043227-110043249 CTGAGTGAGCTCTAGAAATTAGG - Intergenic
1048954549 8:139525129-139525151 CTTCTTGATCCCTAGAAGTGGGG + Intergenic
1050241771 9:3643839-3643861 CTTAATAATGTCTATAAATTGGG - Intergenic
1052201208 9:25783115-25783137 GTTAATAATGTCTAAAAGTTAGG + Intergenic
1055519765 9:77069022-77069044 CTTAATGATTTCTACATGCTGGG + Intergenic
1059124366 9:111669349-111669371 CTGAAATATCTCTAAAAGTTAGG - Exonic
1059378393 9:113904245-113904267 ATTTTTCATCTCTAGAAGTTTGG + Intronic
1059908959 9:119021319-119021341 CTTTATGATCTCTACAAATCAGG + Intergenic
1185944357 X:4357963-4357985 TTTAATGATCTGTAGAAATAGGG - Intergenic
1186991292 X:15071330-15071352 CTTAATGGTCTCCAGAACTGTGG - Intergenic
1189187186 X:39064641-39064663 CATAAAGATTTCTAGAAGCTGGG - Intergenic
1191628038 X:63290031-63290053 CTTGATGATCTTTACAATTTGGG + Intergenic
1193088897 X:77472664-77472686 CTTGATGATCTTTACAATTTGGG - Intergenic
1195757469 X:108213566-108213588 CCAAATGATTTCTAGATGTTGGG + Intronic
1196529543 X:116769101-116769123 ATTAGTGGTCTCTAGGAGTTAGG + Intergenic
1198189910 X:134292685-134292707 GTTGATGATCTCTAGTAGTATGG + Intergenic
1198999830 X:142622147-142622169 CTTACTGATCTCTAAAAGAAAGG - Intergenic
1199558829 X:149140590-149140612 CTTTATTATCTCCATAAGTTTGG - Intergenic
1201939352 Y:19443306-19443328 CTGAATGATCTTTTGAATTTCGG - Intergenic