ID: 981545144

View in Genome Browser
Species Human (GRCh38)
Location 4:145885947-145885969
Sequence CTGGGGCAGCAAAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 739
Summary {0: 1, 1: 0, 2: 8, 3: 59, 4: 671}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981545144_981545155 0 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545155 4:145885970-145885992 GCAGGCACTGTCACTGAGGTGGG 0: 1
1: 0
2: 3
3: 29
4: 261
981545144_981545159 25 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545159 4:145885995-145886017 GATCCCTTGACATCTGGGTCTGG 0: 1
1: 0
2: 0
3: 10
4: 110
981545144_981545156 1 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545156 4:145885971-145885993 CAGGCACTGTCACTGAGGTGGGG 0: 1
1: 0
2: 1
3: 37
4: 270
981545144_981545154 -1 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545154 4:145885969-145885991 GGCAGGCACTGTCACTGAGGTGG 0: 1
1: 0
2: 2
3: 25
4: 212
981545144_981545160 26 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545160 4:145885996-145886018 ATCCCTTGACATCTGGGTCTGGG 0: 1
1: 0
2: 0
3: 18
4: 165
981545144_981545158 20 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545158 4:145885990-145886012 GGGGAGATCCCTTGACATCTGGG 0: 1
1: 0
2: 0
3: 16
4: 141
981545144_981545157 19 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545157 4:145885989-145886011 TGGGGAGATCCCTTGACATCTGG 0: 1
1: 0
2: 22
3: 726
4: 10942
981545144_981545153 -4 Left 981545144 4:145885947-145885969 CCTCCTTCCCTTTGCTGCCCCAG 0: 1
1: 0
2: 8
3: 59
4: 671
Right 981545153 4:145885966-145885988 CCAGGCAGGCACTGTCACTGAGG 0: 1
1: 0
2: 2
3: 28
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981545144 Original CRISPR CTGGGGCAGCAAAGGGAAGG AGG (reversed) Exonic
900104066 1:974747-974769 CTGGGGCAGGGAAGGGTGGGAGG + Exonic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900397242 1:2458132-2458154 CTCTGACAGCACAGGGAAGGTGG + Intronic
900400885 1:2472427-2472449 CTGGGGCTGCGAGGGGCAGGGGG + Intronic
900431613 1:2605554-2605576 CGGCGGCAGCAACCGGAAGGTGG - Exonic
900645642 1:3707526-3707548 CTGGCGCGGGAAAGGGGAGGAGG - Intronic
901142156 1:7042269-7042291 CCAGGGCAGCCCAGGGAAGGGGG - Intronic
901174970 1:7292466-7292488 CTGGGGGAGCAAAGGTTAGGTGG - Intronic
902095935 1:13945895-13945917 CTTGGGCAGAGAAGGGAAGCAGG - Intergenic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
902279825 1:15366336-15366358 CTGCGACAGCACAGGGAAGCAGG - Intronic
902287124 1:15413940-15413962 CTGGAGGAGCAAAGAGAGGGAGG - Intronic
902702411 1:18181545-18181567 CAGGAGCAGGAAGGGGAAGGAGG - Intronic
902719263 1:18293181-18293203 CTGGGGATGCAAGGTGAAGGAGG - Intronic
902954814 1:19918343-19918365 CTGTGCTAGCAAAAGGAAGGAGG - Intergenic
903012601 1:20342318-20342340 GTGGGGGAGCAGAAGGAAGGAGG + Intronic
903041357 1:20533166-20533188 CTGGGGCAGGAGTGGGGAGGTGG + Intergenic
903192336 1:21663728-21663750 TGGGGGCAGCAGAGGGAAGGTGG - Intronic
903341014 1:22654315-22654337 CTGGGGAAGCCAGGGGCAGGGGG - Intronic
903368491 1:22819339-22819361 TTGGGGCAGAAAGGGAAAGGAGG - Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
904375828 1:30081903-30081925 GTGGGGGAGCAGAGGGAGGGAGG - Intergenic
904423685 1:30410004-30410026 CTGGGGCAGCAAGGGAAGAGGGG + Intergenic
904558920 1:31383848-31383870 GTGGGGCAGGGAAGGGGAGGTGG + Intergenic
904591155 1:31616308-31616330 CTGGAGCAGCATAAGGGAGGGGG - Intergenic
904603887 1:31688690-31688712 CTGGGGCAGCACAGGGACGGAGG + Intronic
905205260 1:36339778-36339800 CTGGTGAAGCAAAGGAGAGGAGG - Exonic
905664769 1:39756297-39756319 CTGGTCCAGCAATGGGAATGTGG - Intronic
905772218 1:40645714-40645736 CAGGGGGTGAAAAGGGAAGGGGG + Intronic
906019069 1:42610777-42610799 CTGGGGAAGCAAAAGGCAAGGGG + Intronic
906112330 1:43332292-43332314 CTGGGGAAGCAATGGGAACAAGG + Intergenic
906664126 1:47606655-47606677 TTGGGGCAGCAGAGAGAAAGGGG + Intergenic
906709674 1:47919861-47919883 CTGGGGCAGGAAAGAGAGGGAGG + Intronic
907248924 1:53125118-53125140 CTGTGGCAGCACACGGAAGACGG + Intronic
907265107 1:53254385-53254407 CTGGGTCAGCCAAGTGAGGGAGG - Intronic
907280805 1:53346046-53346068 CTGGGGCTGCTGAGGCAAGGAGG + Intergenic
908599054 1:65719311-65719333 CAGGGGCAGCTAAGGGAGTGTGG - Intergenic
908737419 1:67291104-67291126 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
909405024 1:75279202-75279224 CAGGGGCTGGAAAGGGAATGAGG - Intronic
909583794 1:77266683-77266705 CTGGGGCAGTCAGGGAAAGGAGG + Intergenic
912420089 1:109536786-109536808 CTGGGGCAGAAAAGGGTGGATGG + Intergenic
912519464 1:110235238-110235260 CTGGGCCAGCCGAGGCAAGGGGG + Intronic
912735293 1:112144968-112144990 CTGGGGCAGCTCAGAGCAGGAGG + Intergenic
912856049 1:113169642-113169664 CTGGGGTAACAAAGAGAAGGGGG + Intergenic
912998960 1:114560570-114560592 CTGGGCCAGCTAAGTGAAAGGGG + Intergenic
913516770 1:119611794-119611816 CGGGGGCAGCAAAGGCTAAGAGG + Intergenic
915145593 1:153794304-153794326 TTGGGGAAGCAGAGGGATGGAGG + Intergenic
915219878 1:154366239-154366261 CTGGGGCGGCAGAGGGACGTGGG - Intergenic
915244995 1:154550511-154550533 TTGGGGCAGGACAGGGAGGGTGG - Intronic
915513984 1:156402163-156402185 CTGGGGCAGGAAGGAGGAGGTGG - Intergenic
915564879 1:156707678-156707700 AGGGGGCAGTGAAGGGAAGGAGG - Intergenic
915731644 1:158058406-158058428 CTGGGGCAGGGCAGGGAGGGAGG - Intronic
915819988 1:159012771-159012793 CTGGGGCGGCAAAGGAAGGAAGG + Intronic
916556765 1:165900118-165900140 CGGGGGCAGCAAAGGGAAAAAGG - Intronic
917972443 1:180217420-180217442 TTGGGGGAGCGAAGGGGAGGGGG - Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
919079097 1:192848449-192848471 CTGGGGGAGCAAGAGGAAGCTGG + Intergenic
920057410 1:203202597-203202619 CTGGGGTAGGAATGGGAATGAGG - Intergenic
920933315 1:210408675-210408697 CTGCTGCAGGAAAGGGATGGGGG + Intronic
921232195 1:213084177-213084199 CTGGGGGAGAAAGGGGAAGAGGG - Intronic
921450354 1:215298126-215298148 CTAGGGTAGTAAATGGAAGGTGG - Intergenic
921907381 1:220509473-220509495 TTGGAACAGCAAAGGGCAGGAGG - Intergenic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922416528 1:225427765-225427787 CTGGGCCAGAAAAGGCGAGGAGG + Intronic
922717575 1:227885292-227885314 CAGGTGCAGCAGAGGGCAGGCGG + Intergenic
922890957 1:229061777-229061799 CTCTGGCAGCAAAGGGGAGGTGG + Intergenic
922934281 1:229411491-229411513 CTGGGGCTGGAAAGGGGAGGGGG - Intergenic
923002977 1:230022879-230022901 TTTGGGGAGCCAAGGGAAGGAGG + Intergenic
923015994 1:230127103-230127125 CTCAGGCAGCAATGGGAGGGGGG - Intronic
923262286 1:232278874-232278896 CCTAGGCAGCAAATGGAAGGAGG + Intergenic
923678474 1:236100259-236100281 CTGGGCCAGCAGAGGACAGGAGG - Intergenic
923798570 1:237184252-237184274 CTGGGGCAGAAATGAGGAGGTGG + Intronic
924740963 1:246794053-246794075 CGGGGGCAGGGAAAGGAAGGGGG + Intergenic
1062815997 10:500303-500325 CTGGAGCAGCCAAGGGCTGGTGG - Intronic
1063246087 10:4220278-4220300 CTGGGGCAGAAAAAGGAAGGGGG - Intergenic
1063365188 10:5486336-5486358 CTGCGGGAAGAAAGGGAAGGAGG + Intergenic
1064722195 10:18240779-18240801 ATGGGGGAGAAAAGGGAAGGAGG - Intronic
1065590794 10:27259204-27259226 CTGGGAGAGAAAAGGGGAGGGGG - Intergenic
1065660203 10:27998638-27998660 CTGGGAGAGAGAAGGGAAGGGGG + Intronic
1066223059 10:33355015-33355037 ATGTGGCAGTTAAGGGAAGGAGG - Intergenic
1066250866 10:33631596-33631618 CTTGGGCAGCCATGAGAAGGTGG - Intergenic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1067442617 10:46318092-46318114 CTGGGGCAGAGGAGGGGAGGTGG + Intronic
1067682050 10:48447613-48447635 CAGGGGCAGCAGTGGGGAGGTGG - Intronic
1067686420 10:48468740-48468762 CTGGGGCACAAAATGTAAGGGGG - Intronic
1069807678 10:71136235-71136257 CTGGGGCTGCAACTGGAGGGAGG - Intergenic
1069821880 10:71233518-71233540 GTGGGGAGGCAGAGGGAAGGGGG - Intronic
1069827941 10:71265748-71265770 CAGTGGAAGCACAGGGAAGGTGG - Intronic
1069888460 10:71638463-71638485 CTGGGCCCCCAAAGGGAGGGAGG - Intronic
1070838605 10:79467805-79467827 TTGGGGCAGAGAAAGGAAGGAGG - Intergenic
1071404575 10:85317811-85317833 CTGGGGAAGTCAAGGGAAGAGGG + Intergenic
1071439348 10:85676633-85676655 CTAGAACAGCAAAGGGAAGCTGG + Intronic
1071767377 10:88682974-88682996 CTGCGGGAGAAAATGGAAGGGGG + Intergenic
1072360238 10:94652394-94652416 CTCGAGCATCAAAGGCAAGGTGG + Intergenic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1073034875 10:100557009-100557031 CTGGGGCAGGAAAAGCAAGATGG + Exonic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073829427 10:107364529-107364551 CTGGAGTAGCAGAGGCAAGGTGG + Intergenic
1074547070 10:114409318-114409340 CTGGGGCAAGAGAGGAAAGGGGG - Intergenic
1074761490 10:116670175-116670197 CTGGGGCAGCCAAGGCGCGGAGG - Intronic
1075105652 10:119538498-119538520 CTGGGGGAGCAAAGGCACAGAGG + Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076288225 10:129322246-129322268 TTGTGGCAGCAAAGGGGATGAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076426627 10:130371708-130371730 CTGTGACAGGAAAGGGAAGCTGG + Intergenic
1076431903 10:130409982-130410004 CTGTGGCAGGAAAGTGAAGGAGG - Intergenic
1076434034 10:130427368-130427390 GTGAGGCAGCATAGAGAAGGTGG + Intergenic
1076772597 10:132674548-132674570 CTGGGGGAGAGAAGGGAGGGTGG + Intronic
1077131210 11:973677-973699 CTGGTGCAGGAGAGGGAGGGTGG + Intronic
1077365715 11:2160757-2160779 CAGGGGCAGCAATGGGCAGTTGG + Intronic
1077430809 11:2515181-2515203 CTGGGACTCCAAAGGGGAGGTGG - Intronic
1077497685 11:2894322-2894344 CTGGGGTAACCCAGGGAAGGGGG - Intronic
1077499937 11:2904743-2904765 CAGGGGCTGCAGTGGGAAGGGGG + Intronic
1077753270 11:4997730-4997752 CTGGTTCAGCACAGGCAAGGAGG + Intergenic
1077868030 11:6239302-6239324 CTGGGGCACCAAGAGGAATGAGG - Intronic
1078529719 11:12127615-12127637 CTTTGGGAGCACAGGGAAGGAGG + Intronic
1078900845 11:15641312-15641334 CTGGAGCAGCCAGGGGGAGGGGG - Intergenic
1079008809 11:16811813-16811835 CCAGGGCAGCAGAGGGGAGGTGG - Intronic
1080542352 11:33280013-33280035 CTGGGGGAGCTGAGGGGAGGTGG + Intronic
1081668455 11:44930137-44930159 TTGGGGAAGGACAGGGAAGGGGG - Exonic
1081763388 11:45592593-45592615 CTGGGGCAGCCAGGGCAAAGAGG - Intergenic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083078471 11:60066487-60066509 CTGGGGCAGCAAAGGGGTCAAGG - Intronic
1083096958 11:60260864-60260886 GGGGTGCAGCAAAGGCAAGGGGG - Intergenic
1083270421 11:61569500-61569522 CTGGGGCAGCAGAGGGAGCCAGG + Intronic
1083620522 11:64047185-64047207 CTGGGGCAGGGGAGGGGAGGGGG - Intronic
1083661184 11:64252403-64252425 CAGGGGCAGGACAGGGAAAGGGG - Intronic
1084055072 11:66626681-66626703 ATGGGGCACCACAGGGAGGGAGG + Exonic
1084267066 11:68010549-68010571 CTGGGGGAGAAAGCGGAAGGAGG + Intronic
1084972185 11:72777930-72777952 CTGAGGCAGGAGAGGGGAGGGGG + Intronic
1085477868 11:76799118-76799140 GGAGGGCAGCGAAGGGAAGGAGG + Intergenic
1085907517 11:80782288-80782310 GTGGGGTAGCAGAGGAAAGGTGG + Intergenic
1085925773 11:81018835-81018857 CTGTGGAAGCAAATGGAATGGGG - Intergenic
1086520244 11:87661009-87661031 CTGGAGTGGGAAAGGGAAGGGGG - Intergenic
1086601802 11:88642276-88642298 CTGAGGCTGCAAAGGGCAGCAGG + Intronic
1088407580 11:109498397-109498419 CTGGGGGAGAGAAGGGAGGGTGG + Intergenic
1088695333 11:112361441-112361463 CTGGGGGAACAAAAAGAAGGAGG + Intergenic
1088995060 11:114989022-114989044 CAAGGGCAGCAAAGGGCAGATGG + Intergenic
1089113864 11:116078356-116078378 CAAGGGCAGGGAAGGGAAGGAGG + Intergenic
1089116144 11:116096784-116096806 CAAGGGCAGGAAAGGGAAGTCGG + Intergenic
1089118861 11:116117855-116117877 GTGGAGAAGCACAGGGAAGGAGG + Intergenic
1089139241 11:116273085-116273107 CACAGGGAGCAAAGGGAAGGAGG + Intergenic
1089597230 11:119588363-119588385 CTGGAGCAGGAAGTGGAAGGAGG - Intergenic
1090648856 11:128789110-128789132 ATGTTGAAGCAAAGGGAAGGAGG + Intronic
1090947786 11:131447359-131447381 AGTGGGAAGCAAAGGGAAGGGGG - Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1091282894 11:134391924-134391946 CTGGGGCAGCACATGGGAGTGGG + Exonic
1091394018 12:142698-142720 CTGGGGAAGGGAAGGGAAGCCGG - Intronic
1091528294 12:1328656-1328678 CTGAGGGAGAAAAGGGGAGGGGG - Intronic
1091596281 12:1881120-1881142 CAGGGACAGGAGAGGGAAGGAGG + Intronic
1091618970 12:2071213-2071235 AAAGGGAAGCAAAGGGAAGGAGG - Intronic
1091647749 12:2286635-2286657 CTGGGGCTGCAGAGTGGAGGAGG + Intronic
1091854534 12:3728745-3728767 GTGGAGCAGCAAAGGGAGGGAGG + Intronic
1092083472 12:5736863-5736885 AATGGGCAGCAAAGGGAAGAAGG - Intronic
1092126619 12:6079247-6079269 CTGTGGCAGAACAGGGAAGCTGG - Intronic
1093742697 12:22706425-22706447 GTGGGGCAACAAAAGGAAGAAGG + Intergenic
1095227446 12:39694763-39694785 CTGGGGCAGCTAAGGGAGTGTGG + Intronic
1096146849 12:49284367-49284389 CTGAGGAAGGAAAGGGCAGGGGG - Intergenic
1096623463 12:52879003-52879025 GTGGGGTAGCACAGGGTAGGGGG + Intergenic
1096718915 12:53506965-53506987 CTGGGGGTGGAAAGGGCAGGAGG - Intronic
1097147728 12:56953325-56953347 CTGGGGCAGGAAAACGAGGGAGG - Intronic
1098142983 12:67469607-67469629 CTGGGGCAGCCAAGGGAGTGTGG - Intergenic
1099012514 12:77308996-77309018 CTGGGGAGGGAAAGGGAAAGTGG + Intergenic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1099508594 12:83507453-83507475 CTGGGGTAGAAAAGGCAGGGTGG - Intergenic
1100576523 12:95896696-95896718 GTAGGGCTGGAAAGGGAAGGGGG - Intronic
1101287877 12:103334747-103334769 CCGTGGAAGCAAAGGGAAGTTGG - Intronic
1101354630 12:103965744-103965766 CTGGGGCGCCAACGAGAAGGGGG + Intergenic
1101372012 12:104138480-104138502 CCGGGTCAGCACCGGGAAGGAGG - Intergenic
1101568386 12:105931141-105931163 CTGGAGCAGCAAAGGGATAAAGG + Intergenic
1102221137 12:111195203-111195225 GTTGGGCAGGAAAGGGAGGGAGG - Intronic
1102652322 12:114450879-114450901 CTGGGGCAGCAAGGGGAGGGAGG + Intergenic
1103705163 12:122867391-122867413 CTGGGGCAGGGTAGGGAAGGGGG + Exonic
1103867142 12:124062313-124062335 TGGGGGCAGAAGAGGGAAGGAGG - Intronic
1103896965 12:124279428-124279450 CTGGGGCTGGGAAGTGAAGGAGG + Intronic
1104069416 12:125331217-125331239 CTGGGGCAGCAACGCGGAGGAGG - Intronic
1104378800 12:128288855-128288877 CTGGGGAAATCAAGGGAAGGAGG - Intronic
1104510242 12:129370863-129370885 ATGGGGCTGGAAAGGGAAGATGG + Intronic
1104857743 12:131909846-131909868 CGGGGGAAGGGAAGGGAAGGCGG - Intronic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1106383687 13:29264420-29264442 CTGGGGGAGCTATGGGAAGGGGG - Intronic
1106552518 13:30784514-30784536 ATGGAGCAGAAAAGGGAAGGGGG + Intergenic
1106804574 13:33292977-33292999 CTGAGGCAGCAACGTGGAGGAGG - Intronic
1107109911 13:36685795-36685817 CTTGGGCAGCTAAGTGAAAGAGG - Intronic
1108828951 13:54452901-54452923 CTGAGGCTGCATAGGGCAGGGGG + Intergenic
1109460022 13:62644294-62644316 CTGGGGCAGCAGGGGCCAGGTGG + Intergenic
1109519053 13:63485067-63485089 CTGGGGCAGAGAAGGCAGGGTGG - Intergenic
1110834108 13:80064363-80064385 CTGGGGGAGAGAAGGCAAGGTGG + Intergenic
1111749790 13:92314564-92314586 CTGGGGCAGCAAATGGAAAAAGG + Intronic
1112338791 13:98536185-98536207 GTGGGGCAGCAAGGGCAAGAGGG + Intronic
1114549737 14:23525883-23525905 TTCGGGCACCAGAGGGAAGGGGG + Exonic
1114672130 14:24416965-24416987 CAGGTGCAGCAAAGGCAGGGAGG - Exonic
1115779750 14:36756206-36756228 CGGGGGCAGCTGAGGGAAGGTGG + Intronic
1115952782 14:38739930-38739952 GTGGGGGAGCCAAGGGGAGGAGG + Intergenic
1117197676 14:53356521-53356543 CGAGGGGGGCAAAGGGAAGGAGG + Intergenic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1117377538 14:55129624-55129646 CTGGGGCCGCAGAGCGCAGGCGG - Intronic
1117473900 14:56074319-56074341 CTGGGACAGCAGGGTGAAGGAGG - Intergenic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1117886706 14:60371747-60371769 CTGAGGCTGCACAGGGAAGTGGG - Intergenic
1117998360 14:61499459-61499481 CTGGTGCAGCAATGGGAAGGTGG + Intronic
1118072991 14:62266292-62266314 CTGTGGAAGGAAAAGGAAGGAGG - Intergenic
1118837566 14:69487460-69487482 CTGGAGCAGTTAAGGGGAGGGGG + Intronic
1118902890 14:70001387-70001409 GTGGTGCACCAAAGGGATGGGGG + Intronic
1119437814 14:74609639-74609661 GTGGGGAAGCAGAGGGGAGGTGG - Intronic
1119665194 14:76480367-76480389 CTGGGGCAGCAGAGGGGTGGGGG + Intronic
1119733344 14:76965149-76965171 CTGGGGAAGCAAAGGAACAGTGG - Intergenic
1119750255 14:77072235-77072257 CTGTGGCAGCAAGGAGGAGGTGG + Intergenic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1121455564 14:94036762-94036784 CTCGGGGAGCACAGGGCAGGAGG - Intronic
1121818118 14:96943815-96943837 CTGGGGCAGCCAGGGCTAGGCGG - Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122594272 14:102878691-102878713 CTGAGGCAGCCAAGGGACAGTGG + Intronic
1122924010 14:104891571-104891593 TTGGGGGAGCATAGGGAAGAAGG + Intronic
1122939584 14:104975275-104975297 CTGGTGCAGCTCAGGGAAGGGGG - Intronic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1125716936 15:41824694-41824716 CTTGGGCAGCATAGGTGAGGGGG + Intronic
1126328371 15:47506101-47506123 CTGGGGAAGCAATGAGAAGAGGG - Intronic
1126330491 15:47525928-47525950 GTAGGGCAGCAGAAGGAAGGGGG + Intronic
1128720117 15:69941842-69941864 CTGGGGTAGCACAGAGGAGGAGG - Intergenic
1128970756 15:72102828-72102850 CTCAGGCAGCAAAGGAAAGCAGG + Intronic
1129228525 15:74183715-74183737 CTGGGGCAGCAGCAAGAAGGAGG - Intronic
1129657471 15:77533750-77533772 CTGGGGAAGGGAAGGGGAGGAGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130663577 15:85850822-85850844 CTGGGGGAGAAAAGGAAGGGGGG - Intergenic
1130693466 15:86106347-86106369 CTGGGGGAGCATGGAGAAGGAGG + Intergenic
1131098366 15:89670016-89670038 CTTGGGCAGCATTGAGAAGGTGG - Exonic
1131367432 15:91852997-91853019 CTGGGGCAGAAACCGGCAGGCGG + Intergenic
1131696372 15:94881796-94881818 CTGGGGCAGCTAAGGGTATCTGG - Intergenic
1131755157 15:95551522-95551544 TTTGGGAAGAAAAGGGAAGGAGG + Intergenic
1132481502 16:168547-168569 CTGGCACAGGAAAGGGGAGGAGG - Intergenic
1132525979 16:414946-414968 CTGGTGGAGGGAAGGGAAGGAGG - Intergenic
1133027973 16:2996920-2996942 GTGGGGCAAAAAAGGGAACGTGG - Intergenic
1133198682 16:4189017-4189039 CTGGTGAAGCCAAGGGGAGGTGG + Intergenic
1134042570 16:11079847-11079869 TGGAGGCAGCAAAGGGAAGGGGG - Intronic
1134092800 16:11400385-11400407 GTGGGGCAGCAACTGTAAGGTGG - Intronic
1134222050 16:12362609-12362631 GGGGGGCAGCACAGGGCAGGAGG - Intronic
1134239400 16:12494292-12494314 TGGGGGCTGCAAAGGGAACGGGG - Intronic
1134295310 16:12940304-12940326 GGGGTGCAGCAAAGGCAAGGGGG - Intronic
1135574354 16:23573820-23573842 CAGGGGCAGAGAAGGGAAAGGGG + Exonic
1135655288 16:24243180-24243202 CTGGGGCTGAAATGGGAGGGTGG + Intergenic
1136687290 16:32002922-32002944 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1136787902 16:32946473-32946495 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1136881879 16:33907316-33907338 CTGGGGTGGCACAGGGAAGCTGG + Intergenic
1137000132 16:35222123-35222145 CAGGGGCAGGAAAGGGGAGGAGG - Intergenic
1137761909 16:50947991-50948013 CTGGGGCAGAAAAGAAGAGGAGG - Intergenic
1138267817 16:55672371-55672393 CTGGGGCAGGGAAGTGGAGGCGG + Intronic
1138451971 16:57098432-57098454 CTGGTGCAGCAATGGGCATGCGG + Intronic
1138574270 16:57897544-57897566 CTGGGGCAGAGAAGGGAGGAAGG + Intronic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139908484 16:70382018-70382040 CAAGGGCTGCAAAGGGAAGGTGG - Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141172956 16:81702613-81702635 CTGTTGCAGCAAAGGAAAGGCGG + Exonic
1141578860 16:84983486-84983508 CTTGGGCAGCACAGGCAGGGGGG + Intronic
1141656740 16:85420739-85420761 CTTGGGGAGCCAAGGGCAGGTGG + Intergenic
1142228691 16:88889357-88889379 CTGGGGCAGCGGAGGGAGGGAGG + Intronic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142305157 16:89280526-89280548 CTGGGGCGGCAGAGTGGAGGGGG + Exonic
1203090132 16_KI270728v1_random:1208130-1208152 CTGGGGTGGCACAGGGAAGCTGG - Intergenic
1142806261 17:2372643-2372665 CTGGGGCTGACACGGGAAGGGGG + Intronic
1143065588 17:4244688-4244710 CTGAGGAAGCAAAGGGGAGATGG - Intronic
1143628086 17:8122307-8122329 GTGGGGCAGCGGAGGGAGGGAGG - Intronic
1143838493 17:9712061-9712083 CTGGGGCAGGGAGGGGCAGGGGG - Exonic
1144058521 17:11561416-11561438 CTGGAGCAAGACAGGGAAGGTGG - Exonic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144702364 17:17347956-17347978 CTGGGGCAGGTGCGGGAAGGAGG - Intergenic
1144825185 17:18101785-18101807 CTGAGGCAGCAAGGGGAGGAAGG + Intronic
1145800072 17:27677038-27677060 CTGGGGCAGCCTAGGGGTGGAGG + Intergenic
1146127995 17:30244134-30244156 CTAGGGCAGCCAAGGCAGGGTGG - Intergenic
1146175548 17:30663930-30663952 CTTGGGCAGGAAAGGGATGAGGG + Intergenic
1146272980 17:31496659-31496681 CTGGGGTGGGAAAGGGGAGGAGG + Intronic
1146403639 17:32519369-32519391 CCGGGGCGACAAAGGAAAGGCGG + Intronic
1146689805 17:34865490-34865512 CTGGGGCTGAACTGGGAAGGTGG + Intergenic
1146925971 17:36745719-36745741 TTGGAGCAGAAAAGGGAATGAGG - Intergenic
1147136722 17:38438350-38438372 TTGGGGCAAGAAAGGGATGGAGG + Intronic
1147148269 17:38498591-38498613 CTGGGGTGGCACAGGGAAGCTGG - Intronic
1147185867 17:38712828-38712850 CTGGGGTGGCAGAGGGAGGGAGG + Intronic
1147210741 17:38871117-38871139 CTGGGGAAGCCGAGGAAAGGGGG + Intronic
1147311821 17:39600022-39600044 CTAGGGCAGGGAAGGGAAGCTGG - Intergenic
1147620109 17:41860713-41860735 CTGGGTCATCAATGAGAAGGTGG - Intronic
1148087130 17:45001046-45001068 CAGGAGCAGCAAAGGGAGTGGGG + Intergenic
1148683046 17:49485723-49485745 ATGGGGCAGCAAATGGATTGAGG - Intergenic
1148691068 17:49527311-49527333 CCAGGGCAGCAAAAGAAAGGTGG - Intergenic
1148702484 17:49597675-49597697 GTGGGGGAGCTAAGGGAGGGGGG + Intergenic
1148795065 17:50192947-50192969 CCGGGGCAGCAATGGGAAGGAGG + Intronic
1149661457 17:58336232-58336254 GAGGGGCAGCCAAGGGAAGCAGG + Intergenic
1150077628 17:62206735-62206757 CAGGGGCACCAAAGGGCAGCTGG - Intergenic
1150737663 17:67754183-67754205 CTGGGGCTGCAGCGGGCAGGCGG + Intergenic
1151181266 17:72330515-72330537 TTGGAGCAGGAAAGGGAAGGTGG - Intergenic
1151315160 17:73317339-73317361 CTGGGGTTGCAAATGGAAGAAGG - Intergenic
1151357236 17:73567147-73567169 CTGGGGCCGCAGAGGGCAGCAGG - Intronic
1151540686 17:74763299-74763321 CTGGGGCAGGTAAGTGGAGGGGG - Intronic
1151820628 17:76494888-76494910 TTGGGGCAATGAAGGGAAGGGGG + Intronic
1152235250 17:79135251-79135273 ATGGGACAGGCAAGGGAAGGCGG + Intronic
1152450145 17:80373376-80373398 CTGGGGATGCTAAGGGCAGGCGG - Intronic
1152630320 17:81408080-81408102 CAGGGGCAGCAGGAGGAAGGGGG - Intronic
1152740118 17:82015058-82015080 CTGGGGCTGGAAAGGGAAAGTGG - Exonic
1152780650 17:82226169-82226191 TTGGGGCAGCCAGGGGCAGGTGG + Intergenic
1154139542 18:11810987-11811009 CTGGTGCAGAAGAGAGAAGGGGG - Intronic
1154472852 18:14721847-14721869 CTGGTGCAGCAGAGAGAGGGAGG + Intergenic
1155517546 18:26638651-26638673 GCAGGGCAGCAAAGGGCAGGTGG + Intronic
1155532374 18:26780361-26780383 CAGGGGAATCAAAGGTAAGGAGG - Intergenic
1155620429 18:27772094-27772116 CTGTGGCCCCAAAGGGATGGTGG + Intergenic
1157161471 18:45317971-45317993 GTGGGGCTCCAAAGGAAAGGTGG - Intronic
1157300473 18:46475233-46475255 CTGGGTCACCAAAAGGCAGGAGG + Intergenic
1157589411 18:48827398-48827420 CGTGGGCAGGAGAGGGAAGGTGG + Intronic
1158272647 18:55733443-55733465 CTAGGGGAGGAAAGGTAAGGAGG + Intergenic
1158307159 18:56118619-56118641 CTGGGGCAGCAAATGTCAGAGGG - Intergenic
1158424463 18:57326649-57326671 CTGGGGAAGGAGAGGCAAGGAGG + Intergenic
1158784830 18:60697921-60697943 CTGTGGGAGCAAGGGGATGGAGG + Intergenic
1158984567 18:62801064-62801086 ATAGGGCAAGAAAGGGAAGGAGG - Intronic
1159347195 18:67221465-67221487 GTGGGGCGGTGAAGGGAAGGAGG - Intergenic
1160199318 18:76783120-76783142 CTAGGCCAGCTAAGGCAAGGTGG + Intergenic
1160336988 18:78051040-78051062 CTGGGGCAGCAACGGCATTGGGG + Intergenic
1160501947 18:79406003-79406025 ACGGGGCAGGAAAGGGGAGGCGG - Intronic
1160684600 19:427662-427684 AGGGGGCGGCACAGGGAAGGGGG + Intronic
1160684640 19:427812-427834 AGGGGGCGGCACAGGGAAGGGGG + Intronic
1160770578 19:829024-829046 GAGGGGCAGAGAAGGGAAGGGGG + Intronic
1160779274 19:870748-870770 CTGGGGCAGGACATGGAGGGAGG + Intronic
1160916840 19:1500807-1500829 CTGGAGCAGAGAAGGGGAGGAGG + Intergenic
1160919198 19:1511969-1511991 CTGGAGCAGGGAAGGGGAGGAGG + Intronic
1161168976 19:2803738-2803760 CTGGGGTACAAACGGGAAGGCGG + Intronic
1161335989 19:3713519-3713541 CTGGGGCGGCAAAGGGCCTGCGG + Intronic
1161606807 19:5219637-5219659 CTGGAGCAGAGAAGGGAATGGGG - Intronic
1161684541 19:5696372-5696394 CTGGGGCAGCAGACAGCAGGTGG + Intronic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
1161857409 19:6773528-6773550 CTGGGGCAGCATGGGGCAGGTGG + Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162748032 19:12810265-12810287 CATGGCCACCAAAGGGAAGGAGG + Intronic
1162983414 19:14253980-14254002 CTTGGGCAGGAAAGGGATGAGGG - Intergenic
1163290054 19:16373315-16373337 CTGGGGTGGCCAGGGGAAGGCGG + Intronic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1164569856 19:29366027-29366049 CTGTGTCAGCAGAGGGCAGGGGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164926127 19:32131433-32131455 GTGGGGGAGGAAAGGGAGGGTGG - Intergenic
1164952894 19:32353519-32353541 CTGTGGCAGAAATGGGTAGGAGG + Exonic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165425379 19:35742629-35742651 ATGGGGCAGGAGAGTGAAGGGGG + Exonic
1166383095 19:42365299-42365321 CTGGGGCAGCTAAGGAGATGGGG + Intronic
1166561867 19:43737894-43737916 CTGAGGCGTCAAAGGGGAGGGGG + Intronic
1166670245 19:44705544-44705566 ATGGGGCAGTAGAGGGAAGGAGG - Intronic
1166994475 19:46713788-46713810 CTGGGGGAGGAGAGGGTAGGGGG - Intronic
1166996668 19:46722801-46722823 CCGGGGCAGCAGCGGTAAGGGGG - Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167148133 19:47694674-47694696 CTGGGGCAGCGCTGGGAAGGGGG - Exonic
1167294691 19:48642981-48643003 CTTGGGAAGCCAAGGCAAGGAGG + Intronic
1167557759 19:50206281-50206303 CTGGGGAAGGAAAGGGCTGGGGG + Intronic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1168292351 19:55362733-55362755 CTGGGGCAGCCAGGGAGAGGGGG + Intronic
1168336349 19:55599624-55599646 CTGGGAAAGGAAAGGGAAAGAGG - Intronic
1168405341 19:56107665-56107687 TAGGGGCAGAAAAGGGAGGGGGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168651966 19:58097586-58097608 CTGGAGCAGGGAAGGGATGGAGG - Intronic
1168714473 19:58518943-58518965 CTGGCTGAGCAAAGGGACGGCGG - Intronic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925169736 2:1743628-1743650 CTGGGGGAGGAGAAGGAAGGGGG + Intronic
925176004 2:1784384-1784406 CTGGGGCGGCAAATGGAATCGGG - Intergenic
925186484 2:1850136-1850158 AAGGGGAAGGAAAGGGAAGGAGG - Intronic
925202414 2:1979288-1979310 CCGTGGCAGCAGAGAGAAGGAGG + Intronic
925338240 2:3114590-3114612 CTGAGGCAGCAACTGGAACGTGG + Intergenic
926053771 2:9761706-9761728 CAGAGGCAGGAAAGGGAGGGCGG - Intergenic
926166162 2:10523082-10523104 CAGGGGCAGCAGAGGGCAGTGGG + Intergenic
926170522 2:10550261-10550283 GTGGGGCAGCTAAGGGACTGGGG + Intergenic
926319205 2:11736786-11736808 AGAGGGCTGCAAAGGGAAGGGGG - Intronic
926644505 2:15274573-15274595 AGGGGGCAGGAAAGGGGAGGAGG + Intronic
926662796 2:15486635-15486657 ATGGGACAGGAAAGGGAAAGGGG - Intronic
927073075 2:19549690-19549712 CTGCAGCAGCCAAGGGAAGCTGG + Intergenic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927256530 2:21044580-21044602 CTGGGGGAGGAGAGAGAAGGGGG + Intergenic
927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG + Intergenic
927397129 2:22665405-22665427 CCAGGGCAGAAAAGTGAAGGGGG - Intergenic
927566621 2:24119176-24119198 GTGGGGCAGGATAGGGGAGGGGG - Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929712508 2:44279340-44279362 CAGGCACAGCAAAGGAAAGGAGG - Intronic
929917281 2:46146624-46146646 CGGGGGCAGGACAGGAAAGGAGG + Intronic
930492574 2:52093673-52093695 CTGGGGCAGCCAAGGAAGTGCGG - Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931155153 2:59620169-59620191 TTGGGGAAGTAAGGGGAAGGTGG - Intergenic
932028296 2:68157540-68157562 CTGGGGCAGAATACGGAAAGCGG - Exonic
932552886 2:72789847-72789869 TTTGGGTAGCAAAGGGCAGGGGG + Intronic
933239083 2:79898979-79899001 CTGGGCAAGTGAAGGGAAGGAGG + Intronic
933862762 2:86486727-86486749 TTGGGGGAGGGAAGGGAAGGAGG + Intronic
934652765 2:96101807-96101829 CTGGGGCAGCCAAGAGCTGGTGG + Intergenic
934733013 2:96671246-96671268 CTGAGGCAGGAAGGGGCAGGAGG + Intergenic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935054338 2:99552635-99552657 CTGGGGCAGGGATGGGGAGGTGG + Intronic
935356657 2:102207719-102207741 CTAGGGCAGCCAAGGGAGTGTGG - Intronic
935567199 2:104621297-104621319 CTGGGGGAGAACAGGGAAGCCGG - Intergenic
935576644 2:104717901-104717923 CTGGGGCAGCTAAGGGATGCTGG - Intergenic
936461647 2:112718672-112718694 CTAGGTCAGAAAAGAGAAGGAGG - Intergenic
936542839 2:113365859-113365881 TTTGAGCAGCAAAGGCAAGGAGG - Intergenic
936958217 2:118044728-118044750 GTGGGGCACCAAAGGAAAGGTGG + Intergenic
937345250 2:121121321-121121343 AGGGGCCAGCAAAGGGCAGGAGG - Intergenic
937357810 2:121209199-121209221 CGGGCGCAGCACTGGGAAGGAGG + Intergenic
937387506 2:121449389-121449411 CTGGGGAATCTTAGGGAAGGTGG + Intronic
937973721 2:127568391-127568413 CTGGGGGAGGAAAGGGCAGGAGG - Intronic
937984854 2:127633804-127633826 CAGGGGCAGCAAAGACAAGCGGG + Intronic
939358180 2:141131982-141132004 CTGGGGCAAGAGTGGGAAGGGGG - Intronic
939788655 2:146545849-146545871 CTGGGGGAGAGAAGGCAAGGTGG + Intergenic
940637116 2:156310947-156310969 CTGTGGCATCCAAGGGAAGCAGG + Intergenic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941994717 2:171591459-171591481 CTGGGGATGCCAAGGGCAGGTGG + Intergenic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
942613330 2:177763895-177763917 CTTGGCCAGCCAAGAGAAGGGGG + Intronic
942667180 2:178332231-178332253 CTGGGGCAGAACAGGGCAGCTGG - Intronic
944240451 2:197480688-197480710 AAGGGGTAACAAAGGGAAGGAGG + Intergenic
944943396 2:204654465-204654487 CTGGGGAAGTAAATGGAATGTGG + Intronic
945213840 2:207412544-207412566 CTTGGGGAGCAAAGGGCAGCTGG + Intergenic
945416724 2:209582530-209582552 TTGCTGCAGCAAAGGGGAGGAGG + Intronic
946281384 2:218668202-218668224 GTGTGGCAGCAAAGGGAGGAAGG - Intronic
946306816 2:218860791-218860813 CCTGGCCAGCCAAGGGAAGGGGG + Intronic
946310531 2:218880491-218880513 TGGGGGGAGGAAAGGGAAGGCGG + Exonic
946703740 2:222437528-222437550 CTGGGGGAGAGAAGGCAAGGTGG + Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947127648 2:226888032-226888054 GTAGGGAAGAAAAGGGAAGGAGG - Intronic
947186355 2:227458972-227458994 CAGGGGCAACAAAGGTCAGGGGG - Intergenic
947519811 2:230836857-230836879 CAGTGGCAGCAAAGTGCAGGGGG - Intergenic
947605561 2:231483402-231483424 ATGGGGCAGCCATGGGGAGGAGG + Intronic
947668528 2:231922505-231922527 CTGGGGCAGCAAAGCAGAAGGGG - Intronic
948163771 2:235845424-235845446 CTGAGTCAGCAAACGGAATGGGG + Intronic
948251865 2:236535987-236536009 CTGGGCCAGCAGAGGGAGGTGGG + Intergenic
948653445 2:239463050-239463072 CTGGGTCAGCCAGGGGAGGGTGG + Intergenic
948809512 2:240467517-240467539 CTGGGGCACAGGAGGGAAGGAGG - Exonic
949023744 2:241755364-241755386 GTGGGGCAGGGTAGGGAAGGGGG - Intronic
949036188 2:241816685-241816707 GCGGGGCAGCAAAGGGCATGGGG - Exonic
949036414 2:241817534-241817556 TGGGGCCAGCAGAGGGAAGGCGG + Intergenic
1168894299 20:1313075-1313097 CCTGGGCAGCGAAGGGCAGGTGG + Intronic
1168951590 20:1805526-1805548 CTGGGGATGAGAAGGGAAGGTGG + Intergenic
1168986428 20:2052889-2052911 ATGGGGCAGGAAAGGCAGGGAGG + Intergenic
1169514061 20:6297099-6297121 CAGGGGCACCAAAGGAAGGGAGG + Intergenic
1170873452 20:20229573-20229595 CTGGGTAAGCAAATGGATGGAGG + Intronic
1171142299 20:22753815-22753837 GTGGGACTGCAGAGGGAAGGAGG + Intergenic
1171173260 20:23034090-23034112 CTGGGACAGCGATGGGGAGGAGG - Intergenic
1172006018 20:31819641-31819663 CTGGGGCAGGAGATGGAGGGAGG + Intronic
1172094479 20:32453960-32453982 CTGCGGCAGCCCAGGGAGGGAGG - Intronic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172443898 20:34983414-34983436 ACAGGGCAGGAAAGGGAAGGAGG - Intronic
1173251660 20:41366837-41366859 CTGGGGCCGCGGAGGGGAGGCGG + Intergenic
1173834382 20:46115698-46115720 CTGTGGCAACACAGGGGAGGAGG + Intergenic
1173844579 20:46179838-46179860 CGGGTGCAGCACAGGGAAGATGG - Intronic
1173851262 20:46219908-46219930 CAGGGGCTGTACAGGGAAGGTGG + Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1174092069 20:48057421-48057443 CAGGTGCAGCTAAGGGAAGCCGG - Intergenic
1174993156 20:55535610-55535632 ATGAGGTAGGAAAGGGAAGGAGG - Intergenic
1175462692 20:59165007-59165029 CTGGGGCAATAAAGCGAGGGTGG - Intergenic
1175773262 20:61636884-61636906 CTGGTGCAGCTCAGGGAGGGTGG - Intronic
1175899229 20:62353507-62353529 CTGCGGCAGGGAAGGGGAGGAGG - Intronic
1175919671 20:62444791-62444813 CTGGGGCAGGAGAAGGAGGGTGG + Intergenic
1176161809 20:63652325-63652347 CGGGGGCGGCGATGGGAAGGAGG + Intronic
1176801633 21:13436002-13436024 CTGGTGCAGCAGAGAGAGGGAGG - Intergenic
1177569565 21:22870344-22870366 CTGGGGGAGAGAAGGCAAGGTGG + Intergenic
1177802945 21:25846374-25846396 TTGGAGCAGGAAAAGGAAGGAGG + Intergenic
1178491946 21:33057991-33058013 CTGGGGGAGGCCAGGGAAGGAGG + Intergenic
1179124107 21:38576639-38576661 CTGTGACAGCAAAGGGAGGTTGG - Intronic
1179677403 21:42993040-42993062 CTGGGTTAGAAAAGGCAAGGAGG - Intronic
1179724681 21:43335511-43335533 CTGGGGTAGGAGAGGGCAGGAGG + Intergenic
1180164512 21:46017027-46017049 CTGGTCTAGCAAAGGGAGGGAGG + Intergenic
1180258792 21:46651783-46651805 CTGGGGACGGAAAGTGAAGGTGG - Intronic
1180980829 22:19877262-19877284 CGGGGTCAGCACAGGGAGGGGGG + Intronic
1181459521 22:23077996-23078018 CTGGGGCAGCTAAGGCCAGAGGG - Intronic
1181571640 22:23771164-23771186 CTGGGCCAAGAAAGGGAAGCGGG - Intronic
1182043879 22:27259442-27259464 CTGGGGGAGCGATGGGCAGGAGG - Intergenic
1182231088 22:28838008-28838030 CTGGGTCAGAAAACAGAAGGTGG + Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1183034510 22:35131025-35131047 GTGTGGCAGCCAAGGGGAGGGGG + Intergenic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183666526 22:39249353-39249375 ATGGGGCAGCAAGGGGCATGGGG - Intergenic
1183713495 22:39520428-39520450 TTGGGGCGTCAAAGGGAGGGAGG + Intronic
1183743878 22:39682452-39682474 ATGGGGCAGGACTGGGAAGGGGG - Intronic
1183978937 22:41528462-41528484 CAGGGGCTGCAAGGAGAAGGTGG - Exonic
1184110347 22:42390432-42390454 ATGGGACAGGAAAGGGAAGAGGG + Intronic
1184610987 22:45602964-45602986 CTGGAGCAGAAGAGGGCAGGAGG + Intergenic
1184731701 22:46374221-46374243 CTGGCTCAGGAAAAGGAAGGGGG + Intronic
1185072934 22:48667151-48667173 CAGGGGCAGCACAGGGCAGCAGG + Intronic
1185076865 22:48687809-48687831 CTGGGGCAGCCCAGGGAAGGTGG - Intronic
1185347901 22:50318549-50318571 CTGGGGCAGGAGCGGGAGGGAGG + Intronic
949233041 3:1773976-1773998 CTGGGGCAGCCATTGGAAGTTGG - Intergenic
949873263 3:8607312-8607334 ATTGGGCAGCAATGGGCAGGTGG - Intergenic
950789553 3:15461545-15461567 CTGAGGCAGCCAATGGAAGCGGG - Intronic
950896852 3:16460483-16460505 CTGGGCAAGCAAAGTGAAGTGGG + Intronic
951607492 3:24452304-24452326 CTTGGGCACCAAACGGAAGGGGG - Intronic
951819438 3:26791610-26791632 CTGGGACAGCCAAGGGAGTGTGG - Intergenic
952272152 3:31843628-31843650 TTGGGGCAGCAAAGGAAGGAGGG - Intronic
952948362 3:38496545-38496567 CTGGGCCAGCGAAGGGAGGACGG - Intronic
953121334 3:40045456-40045478 CTGCAACAACAAAGGGAAGGAGG + Intronic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953447362 3:42979562-42979584 CGGGGGCGGCCAAGGGGAGGCGG + Exonic
953768390 3:45761077-45761099 CAGCAGCAGCAAAGGGCAGGTGG - Intronic
953772303 3:45787189-45787211 CAGCGGCAGGGAAGGGAAGGTGG - Intronic
954172031 3:48811951-48811973 CTGGGGCTGCAGGGGGAATGGGG + Intronic
954672009 3:52296277-52296299 CTGAGGCTGCATAGGGGAGGTGG - Intergenic
954702293 3:52456566-52456588 CTGCGGGAACAAAGGGGAGGAGG - Intronic
955350629 3:58190649-58190671 GTGGGGGAGGAATGGGAAGGAGG - Intergenic
956168238 3:66412564-66412586 GTGAAGCTGCAAAGGGAAGGGGG + Intronic
956263790 3:67375635-67375657 TTGGGGAAGAAAAGGGGAGGGGG - Intronic
956837052 3:73104013-73104035 GAGAGGCAGCAAAGGGAAAGTGG - Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957783487 3:84849462-84849484 CTGGGGCTGCACAGAGAAGCAGG + Intergenic
959049305 3:101509268-101509290 ATGGGGCAGCAAAAGTAAGCTGG - Intronic
960165870 3:114400692-114400714 CTGGGGGACCCTAGGGAAGGAGG + Intronic
960244078 3:115380401-115380423 CTGAGGCTGCACAGGGAAGTGGG + Intergenic
960464921 3:117985849-117985871 TAAGGGCAGCAAAGGGAGGGAGG + Intergenic
961380217 3:126492116-126492138 CTGGGGAGGCAAGGGTAAGGCGG - Intronic
961507096 3:127377280-127377302 CTGGGGCTGCAAGGGGTGGGGGG + Intergenic
961643843 3:128381913-128381935 CTGGGGCAGCAGGGAGCAGGGGG + Intronic
962303621 3:134266487-134266509 CTGGGGCAGAAAAGTGCAAGAGG - Intergenic
962440665 3:135412742-135412764 CTGTGGCAGCCAAGGGCAGGTGG - Intergenic
962669222 3:137687946-137687968 GTGGGGAAGGAACGGGAAGGGGG + Intergenic
963442137 3:145354360-145354382 GGGGTGCAGCAAAGGCAAGGGGG + Intergenic
963939300 3:151084569-151084591 CTGGGGCAAGATGGGGAAGGTGG + Intergenic
965634894 3:170770886-170770908 GAGGGGCAGGAAAGGGAGGGTGG + Intronic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
965786247 3:172338356-172338378 CAGAGGCAGGAAGGGGAAGGTGG + Intronic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
966241370 3:177758109-177758131 CTGAGGCTGCAAAGGGCAGTGGG + Intergenic
966971591 3:185049952-185049974 CTGAGGCTGGAAAGGGATGGGGG - Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967817981 3:193815306-193815328 CTGGGGAAGGGAAGGGAAGGGGG - Intergenic
968661691 4:1801282-1801304 CAGGGGCAGCTCTGGGAAGGGGG + Intronic
968726611 4:2250823-2250845 CTGGGGCAGCAGACGCCAGGAGG + Intronic
968762398 4:2449476-2449498 CGTTGGCAGTAAAGGGAAGGAGG - Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969054493 4:4393179-4393201 CTGGGAAAGCAAAGGGCAAGTGG - Intronic
969670659 4:8588281-8588303 CTGGGGGAGCCAAGAGAAGGTGG + Intronic
970194754 4:13542982-13543004 CTGGTGCAGGTAAGGGAAGGTGG + Intronic
971243941 4:24912436-24912458 CTGGGACTGAAACGGGAAGGTGG - Intronic
972095524 4:35342952-35342974 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
973808637 4:54549031-54549053 CTGGGACAGCCGAGGGAAGGGGG + Intergenic
975767405 4:77683449-77683471 ATGGGGAAGACAAGGGAAGGGGG - Intergenic
976225054 4:82789323-82789345 GAGGGGAAGCAAAGGGGAGGAGG + Intronic
976470376 4:85421247-85421269 TTGAGGCAGTAAAGGGGAGGTGG + Intergenic
977176715 4:93828293-93828315 TGGGGGCAGCACAGGGTAGGCGG + Intergenic
977910844 4:102534302-102534324 CTGGGGCTACCAAAGGAAGGAGG - Intronic
978591545 4:110329722-110329744 CTGGGGCTGCATAGGGCAGGGGG - Intergenic
978710186 4:111770681-111770703 CTGTGGCAGCACAGGGCTGGGGG + Intergenic
978879243 4:113680868-113680890 CTGGGGCAGCACTGGGAACTTGG + Intronic
979806146 4:124973656-124973678 CAGGGGAAGCATAGGGAATGAGG + Intergenic
980516313 4:133867098-133867120 CTGGGGTAGTGAAGAGAAGGTGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981567074 4:146113203-146113225 CTGCGGCAGCCATGGGAATGTGG - Intergenic
983516034 4:168657735-168657757 CTGGCAAAGAAAAGGGAAGGTGG - Intronic
984065560 4:175043730-175043752 CTGAGGCTGCACAGGGCAGGGGG - Intergenic
984702829 4:182829061-182829083 CTGGGGAGGCAGAGGGGAGGAGG + Intergenic
984833831 4:184000580-184000602 CTGGGGCACAGAAGCGAAGGGGG - Intronic
985551177 5:534387-534409 CTGGCTCAGCACAGGGTAGGGGG + Intergenic
985567205 5:625115-625137 CTGGGGCTGCAAGGGGAAGCAGG - Intronic
985642116 5:1068552-1068574 CAAAGGCAGCCAAGGGAAGGCGG + Intronic
985689278 5:1298275-1298297 CTGAGGCTGAAAAGGGAGGGAGG - Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
988139297 5:27215223-27215245 CTGGGGCATAAAAGGAAAGAAGG + Intergenic
989154283 5:38329534-38329556 CTTGGGCAACACAGAGAAGGAGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
990546888 5:56831338-56831360 AGGGGGTAGAAAAGGGAAGGTGG + Intronic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991738000 5:69644500-69644522 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991760194 5:69911924-69911946 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991787138 5:70206176-70206198 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991789576 5:70224226-70224248 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991814325 5:70499336-70499358 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991817460 5:70520628-70520650 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991839425 5:70786975-70786997 CCGGGGCAGGAAATGGAGGGAGG + Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991879584 5:71206566-71206588 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
991882024 5:71224595-71224617 CCGGGGCAGGAAATGGAGGGAGG - Intergenic
992183689 5:74222849-74222871 CTGTGGCAGCAAAGAGGAAGTGG + Intergenic
993094530 5:83465957-83465979 ATGAGGCAGGGAAGGGAAGGAGG - Intergenic
993305638 5:86271874-86271896 CGGGAGCAGAAAGGGGAAGGAGG - Intergenic
995390948 5:111639862-111639884 CTGAGGCTGCACAGAGAAGGGGG - Intergenic
995530804 5:113090188-113090210 CTCGGGGAGAAAAGGAAAGGAGG + Intronic
995545738 5:113228550-113228572 CTGGGGCAGCAAAAACAAGAAGG + Intronic
995679537 5:114701502-114701524 ATGGGGTAGAAGAGGGAAGGTGG - Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997283190 5:132661304-132661326 CTGGTGCAGCAGACAGAAGGTGG - Intergenic
997599545 5:135130042-135130064 CATGGGGAACAAAGGGAAGGAGG - Intronic
998066011 5:139159281-139159303 CTGGGGCAGCAAAGAGGGGATGG + Intronic
998130701 5:139649827-139649849 CCGGGGAAGCGAAGGGGAGGGGG - Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998387511 5:141766253-141766275 ATGGGGCAGCACAGGGGTGGGGG - Intergenic
998410024 5:141902825-141902847 CTGGGGGAGCCAGGGGAAGTAGG + Intergenic
998777782 5:145621677-145621699 TAGGGGCATCAAAGGGTAGGGGG + Intronic
1000030242 5:157395249-157395271 CTGGGGCAGTAATGCCAAGGAGG - Intronic
1000250627 5:159491619-159491641 CTGGGAGTGGAAAGGGAAGGAGG - Intergenic
1001309126 5:170598237-170598259 CTCTGGCAGCCAAGGGAAGCTGG + Intronic
1001548261 5:172584038-172584060 CTGGAGGAGGAAAAGGAAGGAGG + Intergenic
1001857112 5:175022561-175022583 CTGGGGCTGCAGGGGGAGGGAGG + Intergenic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002170273 5:177370870-177370892 CTCGGGCAGCAGAGGGCCGGAGG - Intronic
1002405630 5:179027937-179027959 GAGGGGCAGTACAGGGAAGGAGG - Intronic
1002518963 5:179779900-179779922 CTGGGGCTGGACAGGGGAGGCGG - Intronic
1002719099 5:181247029-181247051 CTGGGTCAGCAAAGGGAGCCCGG + Intronic
1002916764 6:1535405-1535427 CTGGGGCAGGAAGCGGAGGGTGG + Intergenic
1002955441 6:1858419-1858441 CTGGGCCAGCAAAGTGAAAGAGG + Intronic
1003010972 6:2427302-2427324 CTGGAGAAGGGAAGGGAAGGGGG + Intergenic
1003248218 6:4402024-4402046 TTTGGGTAGCAGAGGGAAGGGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1004426830 6:15512405-15512427 CGGGGGCAGCAAGCGGGAGGAGG - Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004804771 6:19190843-19190865 CTTCTGCAGAAAAGGGAAGGGGG + Intergenic
1005348009 6:24909452-24909474 CTGGAGGAGCAAGGGGAAGAGGG + Intronic
1005777110 6:29146238-29146260 CTGGGGCAGGGGAAGGAAGGGGG - Intergenic
1005885453 6:30094109-30094131 CCAGGGCAGCCAAGAGAAGGAGG + Intergenic
1006457287 6:34139132-34139154 CGGGGGAAGGAAAGGGAAGCCGG - Intronic
1006479776 6:34282671-34282693 TGGGGGCAGGAAAGGGAGGGTGG + Exonic
1006672410 6:35737570-35737592 CTAGGGCAGAAAAGGGATGGGGG - Intronic
1007727336 6:43924372-43924394 CTGGGCCAGCCCAGGGCAGGAGG - Intergenic
1007772492 6:44202671-44202693 CTGGGGCAGGCAAGGGAGGTGGG + Intergenic
1008081707 6:47202101-47202123 CTGGGGTATCAAAGGAAGGGAGG + Intergenic
1008340787 6:50361595-50361617 CTGGGGCTGCAGATGGAAAGAGG + Intergenic
1008589115 6:52975589-52975611 CTGAGGCAGAACAGGGTAGGAGG + Intergenic
1010517429 6:76790141-76790163 CTGAGGCTGCACAGGGAAGTAGG + Intergenic
1010824222 6:80453240-80453262 CTGAAGCAGCAAAGAGAAGATGG + Intergenic
1011803647 6:91046851-91046873 ATGGGGCAGGGAAGGGGAGGAGG - Intergenic
1012244228 6:96908738-96908760 ATAGGGCAGTAAAGGGAGGGGGG - Intergenic
1012289694 6:97437502-97437524 CTGAGGCATCTGAGGGAAGGGGG - Intergenic
1012520070 6:100110557-100110579 CTGCTGAAGAAAAGGGAAGGAGG + Intergenic
1012525978 6:100178102-100178124 TTGGGTCAGACAAGGGAAGGAGG + Intergenic
1012553152 6:100482526-100482548 GAGGGGCAGCAAAGTGAGGGTGG + Intergenic
1012956118 6:105572007-105572029 CTATGGCAGAAAGGGGAAGGTGG + Intergenic
1013119320 6:107127148-107127170 CAGAGGCAGGAAAGGGAAAGGGG + Intergenic
1013488342 6:110619438-110619460 CTGGGGCAGCACAGTAGAGGAGG + Intronic
1013576071 6:111483926-111483948 CTGCAGCAGCAAAGAGGAGGGGG - Intergenic
1014286719 6:119507332-119507354 CTGGAGGAGAGAAGGGAAGGAGG - Intergenic
1015890771 6:137967813-137967835 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890788 6:137967883-137967905 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1016505711 6:144776642-144776664 CCGGTGGAGCAGAGGGAAGGAGG - Intronic
1016848628 6:148593961-148593983 CTGGAGCAGCAAGGGTCAGGAGG - Intergenic
1016953953 6:149608536-149608558 CCAGGGCAGCAAAGGCAGGGTGG + Intronic
1019057111 6:169231874-169231896 CGGGGGCAGCACAGGGAATTTGG - Intronic
1019150904 6:170005004-170005026 CTGAGGCAGCACAGAGCAGGAGG + Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019460694 7:1156838-1156860 CTGGGGCAGGAAGGGGCAGTGGG + Intronic
1019716469 7:2541623-2541645 CTGGGGCAGCAAGGGGTGGGGGG + Intronic
1022021007 7:26399093-26399115 CTGGGGAAGGAAAGAGGAGGCGG - Intergenic
1022478503 7:30727650-30727672 CAGGGGTTGCAAAGAGAAGGGGG - Intronic
1023030230 7:36084629-36084651 CTGGAACAGCCCAGGGAAGGAGG + Exonic
1023803006 7:43851082-43851104 CTGGGTCAGCACAAGAAAGGTGG - Intergenic
1024270124 7:47635720-47635742 CAGGGCCAGGACAGGGAAGGAGG + Intergenic
1024510400 7:50199550-50199572 CTGGAGCAGCAAGGAGCAGGTGG + Intergenic
1024737755 7:52323569-52323591 AGGGGGGAGGAAAGGGAAGGGGG - Intergenic
1024742559 7:52370862-52370884 CTCGGGCAACAAAGGGAATGTGG - Intergenic
1025870764 7:65431958-65431980 CTGGGGAAAGAAAGGGAAAGGGG - Intergenic
1025996055 7:66528215-66528237 CTGGGGTTGCAGAGGGATGGGGG + Intergenic
1026181128 7:68041907-68041929 CTGGGGAAGCTAAGGGAACTTGG - Intergenic
1027619978 7:80472324-80472346 CTGGGGCAGTAAGGCGATGGAGG - Intronic
1028638343 7:93016047-93016069 AAGGCCCAGCAAAGGGAAGGGGG - Intergenic
1028940815 7:96520580-96520602 CTGGGGGACCAAGGAGAAGGAGG - Intronic
1029372714 7:100159417-100159439 TTGGGGCAGGAAAGGGGAAGGGG + Exonic
1029412836 7:100426830-100426852 GAGGGGGAGGAAAGGGAAGGAGG - Intronic
1029591845 7:101512166-101512188 CTGAGTCAGCACAGGGGAGGAGG + Intronic
1030354273 7:108525801-108525823 CTGGGGCAGCAAAGCCCACGGGG + Intronic
1031920926 7:127600085-127600107 ATGGGGCAGCTAGGGGAGGGTGG + Intronic
1032151660 7:129434529-129434551 CGGCGGCGGCAAAGGGAAGCAGG + Exonic
1032517623 7:132518833-132518855 CTGGGGGAGGGAAAGGAAGGAGG - Intronic
1033420167 7:141198612-141198634 ATGGGCCAGCAAGGGGAAGGAGG - Intronic
1033599057 7:142876145-142876167 CTGGGGGCTGAAAGGGAAGGTGG + Intronic
1034160928 7:148993776-148993798 CTGGGGCACCCATGGAAAGGCGG + Intergenic
1034628765 7:152514597-152514619 CTGGCCCAGAAAAGGGAATGTGG - Intergenic
1035279994 7:157772504-157772526 CTGGGGCAGGAAGTGGAAAGAGG + Intronic
1035479072 7:159167570-159167592 CAGGAGCAGCCAGGGGAAGGAGG - Intergenic
1035492739 7:159294543-159294565 CTGGGGCAGGCAAGGGAATCTGG - Intergenic
1035529031 8:336846-336868 CTGGGGAAGCAAAGGTGAGCTGG + Intergenic
1035645219 8:1213895-1213917 CTGGGCCAGCAAAAGGAGTGAGG - Intergenic
1035721937 8:1798858-1798880 CTGAGGCAGCAATGGGAAGCAGG - Intergenic
1037880090 8:22569058-22569080 GTGAGACAGCAAAGAGAAGGTGG - Intronic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1039824099 8:41158195-41158217 CTGGGGAAGAAAAGGGATGGGGG + Intergenic
1039854741 8:41402517-41402539 GGGGGGCAGCAGAGGGAAAGGGG + Intergenic
1040761469 8:50850131-50850153 CTGGGGTAGCAAAGTGAATATGG - Intergenic
1041632107 8:60099790-60099812 CTGAGGCTGCAAAGAGAAGCAGG + Intergenic
1042059061 8:64798235-64798257 CTGGAGCAGCAAATGGAATTCGG + Intronic
1043035207 8:75188889-75188911 CTGGGGCAGCGAGGAGATGGTGG + Intergenic
1044150827 8:88773336-88773358 CTGGGGGAGAAAAGGCAGGGTGG - Intergenic
1044826737 8:96205790-96205812 CTGGAGCAGGAAAAGCAAGGAGG - Intergenic
1044855361 8:96469869-96469891 CTAGAGAAGCAAAGGGATGGTGG - Intergenic
1044900021 8:96934368-96934390 CTGGGGGAGCTAAGTGAAGAGGG + Intronic
1044922559 8:97181291-97181313 CTGGGGAAACAAACAGAAGGAGG + Intergenic
1044930257 8:97245291-97245313 CTGGGGGAATGAAGGGAAGGGGG - Intergenic
1045221869 8:100207328-100207350 CTGGGGGAGAGAAGGCAAGGTGG - Intronic
1046128253 8:109937784-109937806 CTGGGGCAGAAAAGGGTATTAGG - Intergenic
1046885376 8:119361248-119361270 CTGTGGCAGCGAAGGAGAGGAGG - Intergenic
1047334120 8:123919883-123919905 CTGGGCCAGCAAGGGGGAGCAGG + Intronic
1047527019 8:125642167-125642189 CTGTGGGAGCACAAGGAAGGAGG - Intergenic
1048273846 8:133050916-133050938 CTGGGGAAACAAAGGCAAGGGGG + Intronic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1049246484 8:141565552-141565574 CGGGGGCAGGAAAGGGCAAGGGG - Intergenic
1049325506 8:142019516-142019538 CTGGGACACCAAGGGCAAGGGGG - Intergenic
1049457854 8:142702949-142702971 CTGGGGCACCAAGGGGGAGTCGG - Intronic
1050828785 9:9984743-9984765 CTGGGGCAGCAGAGAGAATTAGG + Intronic
1051961496 9:22769643-22769665 CTGGGGCTGCAATAGGCAGGGGG - Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053585664 9:39455970-39455992 CTAGGGCTGCAGAGGGCAGGGGG + Intergenic
1054580647 9:66909255-66909277 CTAGGGCTGCAGAGGGCAGGGGG - Intronic
1055329940 9:75173316-75173338 AAGGGCCAGCAAAGGGAATGTGG + Intergenic
1055574745 9:77649235-77649257 TTGATGCAGAAAAGGGAAGGTGG + Intergenic
1056067095 9:82947772-82947794 CTGGGGCAGGAAATGGGAGGAGG - Intergenic
1056848452 9:90059995-90060017 CTGGGGCAGCTCTGGGAATGAGG + Intergenic
1057325744 9:94061750-94061772 CTGGGGCTGCACAGGGCAGCAGG + Intronic
1058382823 9:104396614-104396636 CAGGGGCAGCGAAGGGGAGATGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059326534 9:113507276-113507298 CTGGGGCAGCTCCTGGAAGGTGG - Exonic
1059341691 9:113601025-113601047 CTGGGGCAGGGTGGGGAAGGAGG + Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060515034 9:124260116-124260138 CTGGGGCAGCTGAGAGGAGGTGG + Intronic
1060827042 9:126693467-126693489 CAGGGGCAGCAACGGGGAGATGG - Intronic
1060978146 9:127777404-127777426 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1060978166 9:127777454-127777476 CTGGGGCGGCAGGGGGATGGGGG - Intronic
1060978186 9:127777504-127777526 CTGGGGCAGCAGGGGGATGGGGG - Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061238050 9:129353308-129353330 CTGGGGAGTCACAGGGAAGGTGG + Intergenic
1061635030 9:131902320-131902342 CTGCGGCAGCAAGGGGGATGAGG + Intronic
1061675388 9:132212702-132212724 CTTGGGCACTAGAGGGAAGGAGG - Intronic
1062052460 9:134454678-134454700 CTGAGGCAGGAGAGGGGAGGAGG - Intergenic
1062135500 9:134925277-134925299 ATGGGGGAGAAAAGGGAGGGTGG - Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185871540 X:3668819-3668841 CTGGGGCAGAAAAGGGAGAAAGG + Intronic
1186233382 X:7480223-7480245 CTGTGGCAGCAAAGGGAAGTTGG + Intergenic
1186833283 X:13412398-13412420 CTGGGGCAGCAGCGGGTCGGGGG + Intergenic
1188686299 X:33074683-33074705 CTGGGGCATCACATGGCAGGAGG - Intronic
1189069243 X:37847110-37847132 CTGAGGAAGCCAAGGGACGGAGG + Intronic
1192452753 X:71253850-71253872 CTGGAGGAGCAATGGGAAAGGGG - Intronic
1192898728 X:75472166-75472188 CTGGGGGAGAGAAGGCAAGGTGG - Intronic
1193527536 X:82612057-82612079 CTGAGGCTGCAAAGGGCAGAGGG - Intergenic
1195612754 X:106887380-106887402 CTGGGCCAGGAATGGGAATGAGG - Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195923132 X:110002483-110002505 CAGAGGCAGAAAAGGGAAGGAGG + Intergenic
1196036924 X:111155596-111155618 CTGGGGAGGGAAAGGGAAGCAGG + Intronic
1197203218 X:123767105-123767127 CTGCGGAAAAAAAGGGAAGGGGG - Intergenic
1197372959 X:125646868-125646890 CCGGGGCAGCACAGGGCAGCAGG + Intergenic
1197451910 X:126629436-126629458 CTGGGGCTGCATAGAGAAGAGGG + Intergenic
1197613315 X:128663276-128663298 TTGAGACAGGAAAGGGAAGGAGG - Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1199386734 X:147231817-147231839 CTGGGGAAGGGAAGGGAAAGGGG + Intergenic