ID: 981546351

View in Genome Browser
Species Human (GRCh38)
Location 4:145898116-145898138
Sequence CTATAGCCCAGGCTAGAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12000
Summary {0: 1, 1: 30, 2: 491, 3: 4233, 4: 7245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981546351_981546355 23 Left 981546351 4:145898116-145898138 CCGCACTCTAGCCTGGGCTATAG 0: 1
1: 30
2: 491
3: 4233
4: 7245
Right 981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG 0: 1
1: 0
2: 2
3: 18
4: 218
981546351_981546354 22 Left 981546351 4:145898116-145898138 CCGCACTCTAGCCTGGGCTATAG 0: 1
1: 30
2: 491
3: 4233
4: 7245
Right 981546354 4:145898161-145898183 AAGATTTATTATAATAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981546351 Original CRISPR CTATAGCCCAGGCTAGAGTG CGG (reversed) Intronic
Too many off-targets to display for this crispr