ID: 981546354

View in Genome Browser
Species Human (GRCh38)
Location 4:145898161-145898183
Sequence AAGATTTATTATAATAACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981546350_981546354 25 Left 981546350 4:145898113-145898135 CCACCGCACTCTAGCCTGGGCTA 0: 5
1: 412
2: 13779
3: 161985
4: 271744
Right 981546354 4:145898161-145898183 AAGATTTATTATAATAACCACGG No data
981546352_981546354 11 Left 981546352 4:145898127-145898149 CCTGGGCTATAGAGCCAGACGCT 0: 1
1: 4
2: 237
3: 4387
4: 45713
Right 981546354 4:145898161-145898183 AAGATTTATTATAATAACCACGG No data
981546353_981546354 -3 Left 981546353 4:145898141-145898163 CCAGACGCTGTCACAAACAAAAG 0: 1
1: 0
2: 5
3: 189
4: 2205
Right 981546354 4:145898161-145898183 AAGATTTATTATAATAACCACGG No data
981546351_981546354 22 Left 981546351 4:145898116-145898138 CCGCACTCTAGCCTGGGCTATAG 0: 1
1: 30
2: 491
3: 4233
4: 7245
Right 981546354 4:145898161-145898183 AAGATTTATTATAATAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981546354 Original CRISPR AAGATTTATTATAATAACCA CGG Intronic
No off target data available for this crispr