ID: 981546355

View in Genome Browser
Species Human (GRCh38)
Location 4:145898162-145898184
Sequence AGATTTATTATAATAACCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 218}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
981546353_981546355 -2 Left 981546353 4:145898141-145898163 CCAGACGCTGTCACAAACAAAAG 0: 1
1: 0
2: 5
3: 189
4: 2205
Right 981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG 0: 1
1: 0
2: 2
3: 18
4: 218
981546351_981546355 23 Left 981546351 4:145898116-145898138 CCGCACTCTAGCCTGGGCTATAG 0: 1
1: 30
2: 491
3: 4233
4: 7245
Right 981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG 0: 1
1: 0
2: 2
3: 18
4: 218
981546352_981546355 12 Left 981546352 4:145898127-145898149 CCTGGGCTATAGAGCCAGACGCT 0: 1
1: 4
2: 237
3: 4387
4: 45713
Right 981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG 0: 1
1: 0
2: 2
3: 18
4: 218
981546350_981546355 26 Left 981546350 4:145898113-145898135 CCACCGCACTCTAGCCTGGGCTA 0: 5
1: 412
2: 13779
3: 161985
4: 271744
Right 981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG 0: 1
1: 0
2: 2
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
981546355 Original CRISPR AGATTTATTATAATAACCAC GGG Intronic
901807291 1:11746719-11746741 ACATTTATGTTAATAACCATAGG - Intronic
901862826 1:12085814-12085836 GGACTTTTGATAATAACCACAGG - Intronic
902153606 1:14464957-14464979 AGATGTAATATAATAAACACTGG - Intergenic
908410721 1:63861932-63861954 AGATTTATTAAAATAAAAAATGG + Intronic
908505263 1:64791085-64791107 AGTTTTATTATAAAGAGCACAGG + Intronic
908706227 1:66958439-66958461 AAATTAATTAGAATAAGCACTGG - Intronic
908808388 1:67954392-67954414 AGATTTTTTATTATTACAACTGG + Intergenic
908959160 1:69673435-69673457 AGATTAAATGTAATGACCACAGG - Intronic
911821721 1:102432137-102432159 AGATTTATTATTATAAACCATGG + Intergenic
912348798 1:108991461-108991483 ACATTTATTAAAATAAGCTCTGG + Intronic
912694490 1:111830977-111830999 ACATTGCTTATAATAAGCACTGG + Intronic
912769038 1:112445492-112445514 ATATTTATTATATCAAACACTGG - Intronic
919985123 1:202668478-202668500 AGAATTACTATAAGATCCACAGG + Intronic
921027040 1:211294529-211294551 AAATTCATAATAAAAACCACAGG - Intronic
921550649 1:216531701-216531723 AGAATTATTATAAGAGGCACAGG - Intronic
922912491 1:229229441-229229463 AGATTCCTTTTAAAAACCACAGG - Intergenic
923113571 1:230913510-230913532 AGATTTTTAAAAATAACTACAGG - Intronic
923507507 1:234617961-234617983 AGACTTAATATACTATCCACAGG + Intergenic
1064593195 10:16915804-16915826 AGATATATTTTACTAACCAGAGG + Exonic
1064698504 10:17992248-17992270 AGATTTAATAAAATAATCATAGG + Intronic
1064744419 10:18464629-18464651 AGAGTTATTATAGAAACAACAGG - Intronic
1064836470 10:19537163-19537185 AGTTTTATTCTAAAAACCATGGG + Intronic
1065090182 10:22224502-22224524 ATATTTATTATTATAACCTTAGG + Intergenic
1067260390 10:44684773-44684795 AAACTTATTTTATTAACCACAGG - Intergenic
1070241647 10:74688011-74688033 AGATTTTTTTAAATCACCACAGG - Intronic
1071985123 10:91042661-91042683 AGATTTAATAAACTATCCACTGG - Intergenic
1072044486 10:91641109-91641131 AAATTTATTTTAATCACCAGTGG - Intergenic
1072392034 10:94997288-94997310 AAATCTATTATCATAACAACAGG + Intergenic
1073718825 10:106141327-106141349 ATAGTTATTATAATAATTACAGG + Intergenic
1073844675 10:107541376-107541398 TGATTTATTATTATTTCCACAGG + Intergenic
1074660156 10:115646307-115646329 ATACTAATTATAATAACCAAAGG + Intronic
1074692912 10:116022978-116023000 GTCTTTATTATAATAAGCACCGG - Intergenic
1074866911 10:117549843-117549865 AGTTTTTTTTTAATAACCAGAGG - Intergenic
1080112221 11:28581210-28581232 AGATTTATTATGTTAGCCAGGGG + Intergenic
1080991570 11:37543238-37543260 ACATATACTATAATAGCCACAGG + Intergenic
1082981689 11:59130042-59130064 AAATTTATTATAAATACTACTGG + Intergenic
1085189663 11:74607932-74607954 ACATTTTTTATAATAATCATTGG - Intronic
1085488526 11:76890821-76890843 TGATCTATTATAGTAATCACCGG + Intronic
1086571332 11:88287806-88287828 TCACTTAATATAATAACCACAGG + Intergenic
1086994593 11:93341745-93341767 CAATTTATTATAATAACCATAGG - Intronic
1087358361 11:97124016-97124038 AGATGTTTTATCTTAACCACAGG - Intergenic
1087517865 11:99187944-99187966 ATATTTATAATAGTAACCACTGG - Intronic
1090532311 11:127603895-127603917 AAATTTGTTATACTACCCACAGG + Intergenic
1091498082 12:990228-990250 AAAATTATTTTAATAAACACTGG + Intergenic
1092647511 12:10592348-10592370 AGATTTATGAAAATAATTACTGG - Intergenic
1093373678 12:18396825-18396847 AGAATTATCATCTTAACCACAGG - Intronic
1095158051 12:38882507-38882529 CAATTTATTATAACAGCCACAGG + Intronic
1095989644 12:48025873-48025895 AGATTTATTTTAATAAGTATTGG + Intergenic
1099038391 12:77618886-77618908 AGATTTCTTCTAATATCCAAAGG + Intergenic
1099716392 12:86298548-86298570 TCATTTATTATAATAAACACTGG + Intronic
1100580757 12:95938088-95938110 ATATTTGTTTTTATAACCACTGG - Intronic
1102664572 12:114560199-114560221 GGATTTTTTATAATAACAAAAGG - Intergenic
1103755524 12:123203313-123203335 ATATTTATTATAAAAAACAAAGG - Exonic
1103788481 12:123451635-123451657 TGATGTATTATAATAATCACAGG - Intergenic
1105409322 13:20158384-20158406 AGATTTATTTTAAAATCAACAGG + Intronic
1107235548 13:38165268-38165290 AAATTTCTTATAAAAACCAGTGG + Intergenic
1107351288 13:39517681-39517703 AAAATTATAATAATAACCCCAGG - Intronic
1108281214 13:48864012-48864034 AGTATTATTATAATTACTACTGG - Intergenic
1109006857 13:56888353-56888375 ACATTTATTATGATAAACAGAGG - Intergenic
1109171330 13:59100763-59100785 ACATTTATTATAAAACCTACCGG + Intergenic
1109214276 13:59570083-59570105 AGATTTATTATAACAAAGATTGG + Intergenic
1109228015 13:59720467-59720489 ATATTTATTTTAATAAACATGGG + Intronic
1109858005 13:68158101-68158123 AGATTTATGATACTAATTACTGG + Intergenic
1109867735 13:68287491-68287513 AGATTTATTATAAGAATTAGGGG - Intergenic
1111815002 13:93141141-93141163 AAATTCATTATTATATCCACTGG + Intergenic
1113144429 13:107192202-107192224 ATATTAATTATAATAACCTGTGG + Intronic
1116576051 14:46577323-46577345 AGATTTTTTTTTTTAACCACGGG + Intergenic
1116721189 14:48497921-48497943 AAATATATTATAAGAAACACTGG - Intergenic
1116926709 14:50646238-50646260 ACAATTATTATAATAAAAACTGG + Intronic
1120475380 14:84980102-84980124 AGATTTATTTTCAGAAACACAGG - Intergenic
1120482877 14:85074403-85074425 AGATTTATTGTAAAAAATACAGG - Intergenic
1121847620 14:97186987-97187009 AGACTTTTTATAATAATCAGAGG - Intergenic
1122911891 14:104833983-104834005 ATATTTACTATAATTACCAGTGG + Intergenic
1125456307 15:39862856-39862878 ATATATACTAAAATAACCACAGG + Intronic
1129973448 15:79800995-79801017 ACATTGATTACAATAACCATAGG - Intergenic
1130775071 15:86970426-86970448 ACATTTATTTTCATAACCATTGG + Intronic
1131495215 15:92903845-92903867 AGATTTATTTTTATAACCTGAGG + Intronic
1135606928 16:23833539-23833561 AGCATTATTATAAAGACCACAGG - Intergenic
1137451997 16:48584913-48584935 AGATTTATTATATTCTACACTGG - Intronic
1138652790 16:58471306-58471328 TGATTTATTATAGCAGCCACAGG + Intronic
1144169130 17:12641793-12641815 ACAGTTATTAAAATAATCACAGG + Intergenic
1144335565 17:14266132-14266154 AGATTGATTCTAATCACCAATGG - Intergenic
1145068230 17:19779122-19779144 AAATTTATTAAAATAACCATAGG - Intronic
1149420283 17:56503912-56503934 AAGTTTATTAAAATAACAACTGG + Intronic
1149877851 17:60256040-60256062 AGATTTAATAGAAAAATCACTGG + Intronic
1151411024 17:73929758-73929780 AGATTTATTTTACTAGTCACTGG - Intergenic
1155484337 18:26325728-26325750 AGATTAAATATAATAACCAGTGG - Intronic
1156546312 18:37967156-37967178 AAATTTGTTATAACAACCTCTGG + Intergenic
1157959220 18:52133898-52133920 AGAATGATTTTAATAATCACAGG + Intergenic
1159989669 18:74889871-74889893 AGATGAATAATAATAACAACTGG - Intronic
1162202829 19:9033562-9033584 AGATGTACAAGAATAACCACTGG + Intergenic
1164272807 19:23688050-23688072 AGATAGAATAAAATAACCACAGG + Intergenic
927298993 2:21488736-21488758 AGATTTACTATAATTCCCAAAGG + Intergenic
929745970 2:44659033-44659055 GGTTTTATAATAAAAACCACAGG - Intronic
931706873 2:64953649-64953671 ATATTTTTTATAATGAACACTGG - Intergenic
931891799 2:66681385-66681407 TTATTTATTATAAAAACCAGTGG + Intergenic
931922017 2:67029329-67029351 ATATTTATTAAAATAATCATAGG + Intergenic
932891611 2:75601682-75601704 TCATTTATTATAAGAAACACTGG - Intergenic
933233555 2:79837991-79838013 ATATTTATTATAATAATCCTGGG + Intronic
933581348 2:84130238-84130260 ACATTCTTTATAATAACCACTGG + Intergenic
936619434 2:114080101-114080123 AGACTTAATAAAATAACAACTGG - Intergenic
937342923 2:121103387-121103409 TGGTTTATTATGATAACCACAGG - Intergenic
939637591 2:144601505-144601527 AAATTTCTGATAATAACCATAGG - Intergenic
940038705 2:149336769-149336791 AGATTTAGTATTATAACCTCAGG + Intronic
940352890 2:152708354-152708376 ACATTTATTATAATCAGCAGTGG + Intronic
941770002 2:169335092-169335114 AGATTTATTCTGAGAAACACAGG + Intronic
942764638 2:179440395-179440417 AGATTTGTTAAAATTACCTCAGG - Intergenic
942859546 2:180592730-180592752 GGATTTATTATAATAAATATAGG - Intergenic
943173486 2:184434955-184434977 AGTTTTATTAAAATAGCTACCGG - Intergenic
943978563 2:194514937-194514959 AGATTTATTATAATAAGTTATGG - Intergenic
944537734 2:200727893-200727915 ACTTTTCTTATAATAACCAAGGG + Intergenic
944678854 2:202057731-202057753 AGAGTTAGTATAATAATCAGTGG + Intergenic
946206853 2:218115733-218115755 AGATTTATTATGGTAAATACTGG - Intergenic
946492384 2:220161832-220161854 ACATTTATTATAAAAACTGCAGG + Intergenic
1169070087 20:2720916-2720938 AGATTTCTTATCAGAAACACAGG - Intronic
1169604661 20:7303260-7303282 AGATTTAATATAATTAGCATGGG + Intergenic
1171453104 20:25249670-25249692 AGATTTGTTAGAATACCAACTGG + Intronic
1172926395 20:38540627-38540649 AGACATATTATAATATCCAAAGG - Intronic
1173053777 20:39591401-39591423 AATTATATTATAATAACCAAGGG - Intergenic
1179119798 21:38532605-38532627 AGATTTCTGATTATAATCACAGG + Intronic
1181847159 22:25720129-25720151 ACATTTATTATGCTACCCACTGG + Intronic
1183021676 22:35032495-35032517 ATATTTGTTAAAATCACCACTGG - Intergenic
950799444 3:15538096-15538118 AGATATATTAAAATATCCATTGG + Intergenic
950977023 3:17257368-17257390 AGATTGATTATTTTAAACACAGG - Intronic
951129567 3:19025692-19025714 AGATTTTTTTTAAAAATCACAGG + Intergenic
954924626 3:54221739-54221761 AGATTACTTATAATAACTAATGG + Intronic
957252865 3:77796652-77796674 AGATGTATTTTAATAACTAACGG + Intergenic
959184173 3:103023347-103023369 AAATGTATTATATTAACCATTGG + Intergenic
959344493 3:105176155-105176177 AGATTTAATATTTTAATCACTGG - Intergenic
959593310 3:108102521-108102543 AGATGTGTTTTAATAACGACAGG + Intergenic
959697754 3:109267406-109267428 ACATTATTTATAATAACCTCAGG + Intergenic
961968372 3:130930775-130930797 AAATTTATTTAAATAACTACAGG + Intronic
963155629 3:142093246-142093268 GAATTAATTATATTAACCACAGG + Intronic
963969376 3:151412977-151412999 ACATCTATTATTTTAACCACTGG + Intronic
964309507 3:155377548-155377570 ATTTTTATTATATTAACCACAGG + Intronic
964586252 3:158306566-158306588 AAATTTATTATAATCAATACAGG + Intronic
964843263 3:161017710-161017732 AGATTTATTCTTATAAAAACAGG - Intronic
964911474 3:161787494-161787516 AAATTTATTATAATTACCTTTGG - Intergenic
965264818 3:166529601-166529623 AGATTTATTTTATTAACTACTGG + Intergenic
965928781 3:174016446-174016468 TGCTTTATTATAATAACCACAGG + Intronic
966508899 3:180738536-180738558 ACATTTCTTATAATAACAATTGG - Intronic
967367653 3:188705915-188705937 TGATTAATTATAAAAAGCACAGG - Intronic
967761640 3:193232518-193232540 GGATTCATTAAAATCACCACTGG - Intergenic
969852558 4:9971658-9971680 AGATTTTTTAAAAAAATCACTGG - Intronic
971218775 4:24686123-24686145 GGGTTTATTTTAATAAGCACCGG + Intergenic
974475664 4:62376185-62376207 AGAAATATTTTAATAACTACTGG - Intergenic
974572146 4:63666744-63666766 AGATTAAATATAAAAAACACAGG - Intergenic
974615945 4:64282888-64282910 AGCTCTATTATAATAACTATAGG - Intronic
975920064 4:79375117-79375139 AGTTTTTTTATAATGAACACTGG + Intergenic
976322659 4:83733555-83733577 AGATTTCTAAAAATTACCACAGG - Intergenic
976799014 4:88967178-88967200 ATAATCATTATAATAATCACAGG - Intronic
976828585 4:89287389-89287411 AGTTTCATTGTATTAACCACAGG - Intronic
978676236 4:111321066-111321088 AGATTTATTCCAATAACCCAAGG + Intergenic
980012114 4:127607988-127608010 AGATTTATTATATTCTCCAAAGG - Intergenic
980460937 4:133112159-133112181 AGATCTTTTAAAATAATCACAGG + Intergenic
980791288 4:137622580-137622602 AGGTTTCTTTAAATAACCACAGG - Intergenic
981546355 4:145898162-145898184 AGATTTATTATAATAACCACGGG + Intronic
982060567 4:151600573-151600595 TGATTTATACTAATAACCAATGG - Intronic
982320869 4:154076380-154076402 ATGTTTATTGTAAGAACCACAGG + Intergenic
983624011 4:169786598-169786620 ATATTGTTTATAATATCCACTGG - Intergenic
984471784 4:180185153-180185175 AGCTTTATTTTAGTAACCATAGG + Intergenic
991900819 5:71458429-71458451 AGATTTATGATAATTATGACAGG - Intronic
996106125 5:119505900-119505922 AGATTTTTTTAAATAACCATTGG - Intronic
999351935 5:150880392-150880414 AGATTTACTAAAATAAACCCAGG - Intronic
1004045980 6:12023234-12023256 AGACTTTGTAAAATAACCACTGG - Intronic
1004173753 6:13320783-13320805 ACTTTTATTCTAATAACAACAGG + Intronic
1004380618 6:15129192-15129214 AGATTAATTATAATGACTTCTGG + Intergenic
1004978663 6:20997513-20997535 AGGTTTATTTTGAGAACCACGGG + Intronic
1005313291 6:24580179-24580201 AGATGTACAATAATAACCAAGGG + Intronic
1006974407 6:38085003-38085025 TGATTTATTTTGAGAACCACAGG + Intronic
1009226449 6:61024362-61024384 ATATTTTTTATAATACCCAGGGG + Intergenic
1009247283 6:61254507-61254529 AGAAATCTTATAAGAACCACAGG - Intergenic
1009395840 6:63199613-63199635 AGATTTATTATGAAAAAAACTGG - Intergenic
1012535685 6:100294039-100294061 AGAGTTATCATAATAAAGACCGG - Intergenic
1012543447 6:100390368-100390390 ACATCTGTTATAATAACCAACGG - Exonic
1012801718 6:103838404-103838426 ATATTATTTATAATAACCTCAGG - Intergenic
1013427175 6:110023298-110023320 AGATTTATTAGAACAACAAGTGG - Intergenic
1014033263 6:116734293-116734315 AAATTTATTATAGTGACTACAGG - Exonic
1014351210 6:120348594-120348616 TTATTTATTATAATAAGTACAGG - Intergenic
1014505976 6:122256834-122256856 AGATGTATTAAAAAAACAACTGG - Intergenic
1014642924 6:123935799-123935821 ACATTTATATTAATAATCACTGG + Intronic
1015097577 6:129433794-129433816 AGCATTATTATAATAAAAACTGG + Intronic
1015208026 6:130663414-130663436 AGATTTGAAATAATAAACACAGG + Intergenic
1015226458 6:130862478-130862500 GGATTTATTCTACTATCCACTGG - Intronic
1016195784 6:141337522-141337544 ATATTTAGTCTAATACCCACTGG + Intergenic
1016592659 6:145763785-145763807 AAATTAATTATAAGAAACACTGG - Intergenic
1017037127 6:150276732-150276754 AAATTAATATTAATAACCACAGG - Intergenic
1020336027 7:7063011-7063033 ATATTTATTTTAATATCCAGGGG + Intergenic
1020337368 7:7072347-7072369 AGATTTTTCATAATATCCCCGGG + Intergenic
1020466905 7:8490245-8490267 AGATTAATTTTAAAAAACACAGG + Intronic
1021683896 7:23162846-23162868 AGATTTCTTAGAGAAACCACAGG - Intronic
1023045979 7:36210557-36210579 AGGTTTATTCTAATAGCCGCAGG - Intronic
1023096122 7:36661531-36661553 GGATTTATTATAAGAACCTAGGG - Intronic
1027855914 7:83511004-83511026 AGATTTATTATAATTAAAAGGGG + Intronic
1027890751 7:83970767-83970789 AAAATTATAATAAAAACCACTGG - Intronic
1027950978 7:84815317-84815339 ATATTTATTATAATGACCACCGG + Intergenic
1028034767 7:85967793-85967815 AGGGTTCTTATAAAAACCACTGG - Intergenic
1028712313 7:93923225-93923247 AGATTTATTATAACTAGAACAGG - Intronic
1029263521 7:99320723-99320745 AGATTTATTTCAATTACCAATGG + Intergenic
1031520439 7:122758405-122758427 GTATGTATTATAATGACCACAGG + Intronic
1032763209 7:134964510-134964532 AGAGTTATTATAACATCCCCAGG - Intronic
1035940482 8:3895064-3895086 TGTTTAATTATAATGACCACTGG - Intronic
1037007464 8:13799812-13799834 AGTTTTATTTTAAGAGCCACGGG - Intergenic
1040744519 8:50625070-50625092 AGATTAATGATAATAACCAAGGG + Intronic
1042335429 8:67625266-67625288 AGATTTTTTTTGATAAACACAGG - Intronic
1042461045 8:69069174-69069196 AGGTTTATTATATTCACCACGGG + Intergenic
1043699959 8:83273413-83273435 AGATATTTTCCAATAACCACTGG + Intergenic
1043858736 8:85291065-85291087 ACATTTATTCAAATAACCAGTGG - Intergenic
1044848350 8:96403986-96404008 AAATTTGTTATAGTAGCCACAGG - Intergenic
1046368105 8:113263011-113263033 AGATTTATTTTAATATCCCTAGG + Intronic
1046581630 8:116100121-116100143 ATATTTAATGTACTAACCACCGG + Intergenic
1046867869 8:119170993-119171015 TGATTTGTTACAATAACCAAAGG - Intronic
1046925080 8:119777817-119777839 CGATTTATTAGAATAACCAGTGG - Intronic
1047550706 8:125869598-125869620 TGATTAATTGAAATAACCACAGG - Intergenic
1050089881 9:2007084-2007106 AAAGTTCTTATAATAACCACTGG - Intergenic
1050247940 9:3711367-3711389 CAATTTTTTATAATAAACACAGG - Intergenic
1050365230 9:4867972-4867994 AGATTTGTTATATTAGCCAGTGG + Intronic
1052232352 9:26168857-26168879 AAATTTAATATAATAATAACTGG + Intergenic
1052670369 9:31549592-31549614 AGATATATTTTAAAAACCACAGG - Intergenic
1053290723 9:36878205-36878227 AGATTTGTTACAGTAGCCACAGG + Intronic
1055867814 9:80837045-80837067 GGTTGTATTATAATAATCACTGG - Intergenic
1056995488 9:91453579-91453601 AGTTTTATTAGTATACCCACAGG - Intergenic
1058247014 9:102640199-102640221 TGTTTTATGATAATAGCCACAGG + Intergenic
1058921213 9:109617009-109617031 AGCTTTATTAAAATAGCAACTGG - Intergenic
1059812064 9:117866230-117866252 AGATTCATTAGAGCAACCACTGG + Intergenic
1185706085 X:2267179-2267201 AGTTTAAAAATAATAACCACAGG + Intronic
1188023058 X:25179375-25179397 AGATTTATAATAAAAAACATTGG + Intergenic
1188354487 X:29174609-29174631 AGATTTATAGTAAAAACCAATGG + Intronic
1188591218 X:31837881-31837903 GTATTTATTATAATAAGAACTGG - Intronic
1189747319 X:44182728-44182750 AGATTAGTAATAATAATCACAGG - Intronic
1190538344 X:51451375-51451397 TGATTTATTCTAAAACCCACTGG + Intergenic
1193106701 X:77683768-77683790 AGATTTCTTATGTTCACCACCGG + Exonic
1193136176 X:77973007-77973029 AAGTTTCTTATGATAACCACAGG - Intronic
1193476209 X:81969515-81969537 ACCTTTCTTATAATAACTACAGG - Intergenic
1194404832 X:93483403-93483425 AGATTTATGAAAATAAACACAGG - Intergenic
1194898544 X:99475877-99475899 AGAATTATTATGATCACGACAGG - Intergenic
1195431328 X:104792705-104792727 AGTTTTATTCTAATAACTGCAGG - Intronic
1195437604 X:104863370-104863392 AGATTTATTATAGTACCCCAAGG + Intronic
1198973346 X:142305718-142305740 CGAGTTATAATAATAACAACAGG - Intergenic